Description :
Non Conding Region
Location :
Scaffold_1:54416- 59798
Sequence
5382 bases(100 bases per row)
CCGTCACGGTCGAGTCAGGTCAAGAGTCACTAACTGATTCAAGGTAAAAAAGTATTGTATGTGGTATTGTATGTGGAGCCCTCATAGGTCATTAAAGCCA
GGTTCACTTCAGTAAAATGGCTTCGAGCTCGTCGCGTTCGGCGCTGGAGAGCATGTCGAATTGCCACACTTTGGTCTTCTTCCTGCCACTGCTTTTGCTC
GCCTTAGTGGCGGAAATGACGACGGTGTAGCTCTCGGCGATGTCCTTCGAGGACGAAAGTGACCGGAACAGGCCCTTCTTGGACGGCGACGGAGGGCTGG
CCTTCCCAGTGTCCAGCGCCGAGATGTCGCTGAAAGCGATGACCGACGTCTTGGCGGAGCGTGGGGACGATGGATTCGGGGGCATAATATGCAGGCATTT
GTTTAACTTGTCGACCACCAGGTGCCTCGATGATCGAGAACCCGACCACGCCGCCTGAAAATTCGAGAGCGGGGCGTTAGCAAAAAGCTGATTTCAAGGA
AACTCAAGGCTCAATTTACCATGGTAATCATGAACGTCGATGAGTTCAAGGCGGGCTCCTGCTTGATACTGGATAAGCCGACCTGGGCTGTGGCGCTGAT
GGCATCCGCGGTGCGAATGGATAGCGCTGGAAGTGCTGAAGGAGGGACAATTGGGTTTATCTGCAGCGGGGGAGGGCGCATTCGGGATGACTAAGACAGC
AACATTTGTCAACTCAATAAACAGGAGCCACATTCACTCGCGCACTCATACCTTTGTCGTGGGAGCGTCTTCTGCTGACTCCACTCCGACAAACCTGACA
GAGGATTTTGCAACAGCGGGGGATGCTTGCTCGGCGATATCTGAAGCAGTATTCGACACCGAGGTTGGCGGTGATGCTGACGTGGCGTGGTGATGATAAT
CAAGGTCGAACGTGAGAGTCTTCTGTATTCCTGCAAGAGTTCCTAGAATCCCGATAATGTCATTCAGCGGCAATGCTCGTACATCCACATTATCGATCGC
AATAAGGCGACTACCAATCGGAACCTCGTCATTGGAATCACTCTTGGCCACGTTTGTGGTGCACGCGATGTTCTCGAGGGAGCTGTCGAATTCGATTCCC
ATGGGAGATTTAGAGATTACCACATGCTTCAGTCCAGGGTTGCACTCGGGACTAAGCATCTCTTCGTAAGCTGAAGTAGTAGTGCTGAAAGTGATCACCT
TTTCGTGGGATGCGAATAATTGCAGAATCTGACTCAGCTCTGCAATCTGCAGTGAACTGACATCGAATCCATCGATTGCAAGTATCTCGGAGCCATTGAC
AACACCTCCGTGATTGAAAATGCGAGTGGGGCCACGGGCGGGATCCTCGTTCGCGCGATCGACTGCTGCTCTGTTGAATGTGGACATTTTCAGATCAATG
CCCAATGGGCCGGGTGGAAGTCGGATACTCACTGTACGAGAATTACACTCATGGAGGTTGGCACGAGTTGAAAATTCGAGCTCTTTAGACACCGAGGATA
ACTTCTGCAGTAACCCGACGGTTTGGCTCAGGGTCAAACATGACACGTTCATCTTGTTGATGCTTCGGAGTATGGACCCAATTGGAACACGACAGCTTTG
TTCGATCACTCCTGGCTTACCGTTTGCCATCGGATTGAATCCTGCCACCCGAGCAACATCATCCTGACCGCCGTCGAATTTGATTCCCAATGGACCTGGA
AGTACGCTGATGGCCACCAGTTCGTTGGTTTGTTTCAAACACTTCATTAATGATGCATTTGCAACCGCGATCTGCTTCGAAGTATGCCGTAATTTTGAAA
AGAGCTTCGAGATGTCGTCAAGTGTGTGCTGGTGCACCTCGAGCCCGTTGATGGCGATGATGTAGCTCCCAGGAACGAAATCTTTCAACTCCTTGCACGT
TGGGCGATCAGCATCTGCTGGGGTAGTGAACCCCGTGATTCTAGCGTGGCTGGGGTCACTACTGTCTAGATTCAGTCCCGATGGCCCTGCATTGATCTGC
AGTATATGACATTCCGGCAGGATTGCCGCCTCTCGGTGGTAAAAAGTAAGAACTTTTGGATATGGAGTTTGATTCAGCAACTCCACCGCATCAAGCCGAT
TCATGCTCGTAACATCGGTGCCATTAACACCAATTAAAACATCTCCTTTCACAACTTCATTCCCGGCAGCGGCACCAATTGAAGCCACCACACAGCGAAA
GTTATCAGTGTCAGCAATAGTGACATCAGCATCATCAGAAAAAATCTCAAGTTGAGAGAACCGAGTGCAGGTGCTGGGAGTCATGCGATACAGAACGATC
TCCTTGTCTTGCTCTTTCATTCCTGCCAACACCTTTGTTACCTCTTCTCGTGGCAGCCTAGACACATCTGCCCTGTTGATGTTGACTATTTGACAGCCAC
GATGAATATTTAGGCAGGCTTTGAAGTGGTTTGTCGGTTGAAAGTCTTCAATGATGGCACCATAGCAAACAGTATCACTAAGAATCAGTCCTAGCGGTCC
ACTCGAGGTGCGAATTAGAACCAACTTTTCGGGATCGTAGTTATTGATGCTGCGCTGCGCTTGGTGATACCGAGCGAACTTCAGGTACCGCTTTTTCGCC
GCTAGCCTTCCCAGACGCGCGATGACCTCAGACAAGCCAGAATGAGTGATATCGTCGCCATCAACAGCTACTAGACGATCGCCTTCACGAACCGCCTCGC
GCAGAGCTACAAGTCGTTGTTTATCGCTATCGCTGGAACCTCCTTGGTCATCAGCAGGAATTTCAAAACCACGGACAACAACAAAGCCACGTTCATTTTC
AACCAGCAAGATACCCAGTCGACCCGCAGGAGCTTCTGCGACGAAATGCTCGCGTCCGAACTCGTCCACATCCATTCTATGCCAAACAGTGCCAGTTTTG
GAGTGCTACAGTTGTGGCGTTCAGTCTTGTTGCTCAACCGCCAGCAGTATTTTAGCACTTCACAGGACGGTTCAAAATACCCCCCCCCCCCCCGATAAAT
ATAGAGCAGGAGAATGGAAACCTCAGAAATTCGTCGTTCAATCTTACGGGTTTGTTTGTATGCAATTCGCCATTCATGTTGAACAGAGTGAAAAACCAAA
ATGAAAAAAATGCGCTTGAATTCGTCGTGCAGCTTGCACGAAAACACTTGTAGGTCAATAGAAATGCTTGGCGATTGTTTGGTGCAGACTTTCGTGCAGA
TGCATATATTTTTGAAAATAGCCCTGAACTCTGCCTTGTGAGGTGTTGGCCAAAGTCTTATCCCTAACGACTTCTACGAACCACGTTTACCCTGCTCCCA
TTTACGTCGTCGGCCAGCCTACTAGTGCGTTATAACGGAGTCCCGCTCGTCGTAACCCACAAACTGGCTGCTAAACTCGATGTCATTGGCAACGTCGTAC
TCACGCATTTTTACTGGTATGCCTGATCAACGAGCTAAGCGGTTCCCATGAATTCTCGATATCCTGGAGTCCTTGTCACAAAACAAACACCTTCCACTGC
TTAGTGATATCGTTGAAGCGATGTTCAAACAGGGCTTCCACTATCAGCGTGACGCCTTTCTGAGTGATGTGGCCCAGCCGTTCCTCATTGATCTCTAGAC
CGGAGTCATCATATAATATGAGTCGGGTATCATGCACGTCATGATGATCATCTATCATCAACTGCTCAACGATAATGGAGTGGTATCGGATCTCAATGAT
ACGAAAAGGCCCAACCCACGGAACCCTCTGCTTGTTCCCGTCGAATCTCTCCTCAACACGTGACCATAACACAAAGTCACCATTCGTGAAATTGTAGGGC
TGACCTTTCTTGGCTGTCATCAGGTAATGGCGCTGTCGCTCTTTCTGGTCCTTTACCACCGCGTGAAGTGCATGCAGTACGTCGCGTAATTTGTACAGAT
TGAGGGGAATCGACCTGTTTCAAGTCGAGCGGTTTGCTCCTTCTCTAAGTAATAGCAGTACGTCAACCGGTGTTATCGTAGGTAAGCCCGTGAATAATTC
CACCGGAGCTGCGTTGGCGTGTAATGCCACTGGGGAATTATTAAGGTTGTACTGTACAACTGGGAGGACATACTCTCAATTCCTGGTGTCCAACTTCCAC
TCCAGTAGTAGCACCTGAGCCACTTGCTGGATGTCGCGGTTTAGTCTTTTCACGGTGCCGCTTACCCACAGCGTATAGACCGAAGTAAATATTTGCAAAG
CACCAACTCTGCGACTCAAGTAATTCATAACTTGTTTTTGAAGTGGCTGACCTGGTCAGAAACCCAGAAAACGAATCGCTTTACCCAATCGAGTACCGCT
GCAACTACCACACTGCTGGTGGTCGTATCACACGGCACTAGCTTGTAAAAATGCGTTAATTCATTAAGGACGAGCACACAGTGGGCCGATCTATAGTTTT
GTGCAGAACTTCGTTGCGAGTGACAACACCCAGCGGCTCACTACATGGTCGCTGTATCAGTTTGCGTCCCTCCACATCCTTGCAAAGGAGGTAGGCTCGT
TGAAATCGTTTTGCCAACTTAGCCACATCGGCAATTGAAAAGTGCTGCTTGAGGTGACTTGCTCACCACGCTGCACAAGGTGTCTAGCCTGAGCAGAAAC
CCACAGCTTCCCATCTTTGTACAATTCTCTGTCGTCGTTGCCTGACAGATCTATCGTGTCATAACGCCAGCGTTGCTGCTGCTCAGCCACTTCTGCACGT
TTCCCATCCGCCAGCGATCTCAGCGTCGTCACTATCCGCTTACTGCGCGTTCAAAACCTTTTCACGGTTGTGATCGCATCAGTGGTCCCCAACGTGAAAC
TAGATCCACCCATAGTTGTCACACACGCTGGTATGCTGGATCTCGTATTTGTGCCCAGCCAGGCACATTGCCCACCGTTGCAACTTGCCACGGATGTGCT
GCTTAAGCTCCTAGTGGGAGCAGAAAACTTTGATCAGGTCCATTTCGATGACTGACCAATTGAGTTGGGCCCCCCTCTGCAGAGGGGCTTGGTCACGCAC
AGGCACATCCAATTGTTAATCAATCACTTGGGTGAGGACCATTGCCCACCCAAAGTGCAAAGCGTCTGAGCACATGACCAATGTGGCGTCGGGGTTTGGG
AGCGACAACCTAGGCAAGCACATCAAGAGAGCAATCAATGTCTTGGAAGCCTCCTTAGTTGCCGGAGGCCACTGTATCCGCACTCTATGGTGCGTGAGGG
CCGTGGTGCGCTACCATAATACGAACACAACGCGTTATGTAGTGGATTGATTTTTCTTTCCATTCGTTCGTGTTCCCCTGAGGTAAAGTGGCGTCCAGCC
CGTCCGCTTCCCCAAACAGAAACTCAACTTTCAGTCCCTCATTTCTTGACAATGTCCGGATGCAGCGGCGACACAACCCGAT