Description :
Non Conding Region
Location :
Scaffold_1:5435- 5637
Sequence
202 bases(100 bases per row)
GGGACTACGGAATTCGGGGGATCTGGGGGACGCCACTTCAATTGTGGACCAGTACTCGCGGGTGTAAAAACACTAGGATTTTTCGTGTGGCCGTTGTGAA
TTTAATATTTTACTTACGTTGAAGATTTACGTACCCATGACACAATTCTTGCAATTTGTGACCGTTCATAGTTAAGGGTTAATCCACATCGACTCCTCAA
AA