Description :
Non Conding Region
Location :
Scaffold_1:54179- 54852
Sequence
673 bases(100 bases per row)
TAACACAGACAGCGAGACAAAACGCAAGGTGAGACTACATCTGTTTTGATTGGGCCGCTTTCCCCGCGATTTGACGCAGTGATTGTTGATGAAGTGCTTC
ATCTCGCCAGTGCAGGATCTTGGTATCCTCCGACTGGACCGGTTGCAGATACCCAAGGTATCGTCGCCTTGCGTTACTTGTGTTGCCTCACGAGATTGCT
GACCTCATCTTGATCGTTTGTGATTGCGGAATCTGGTGCTCGAACCAATACGATACTTTCGACAATCAACTGTCGATTGGCACCCAAGTGCGCATGCTTG
TCAGCCTCACACTCGATGGATGTATATCCCAGAGTGTCGGTGACGGTTGATTCAGCAGTGTCGTCACTGGAGAAAGAAGTCGATGACTCGATGCTTGCGA
GTCTCTCCCTCAACAATGCTTCAGTGAAAAAGCAAGCGCGAAAGAGTGTCCATGACACGTCTACTGTACACGTGGCCAAACAGCGCAGCGCACTTGAAGA
CAAAGCAGATTCGACCCAAGAGAAAGGCAATCTGCAAAATTGCGATATCCGGTGCGACGGGAACCAAGAGACACAAGATCCGGAGGAGCATAGGCCAGAG
CGAGCATCGCCACTCAAGCTGAATCAACTGTCAATTGCTTTCGACAAGCTTTTCAATAATGACGAAAACAAGA