Description :
Non Conding Region
Location :
contig_1:54009- 56933
Sequence
2924 bases(100 bases per row)
AATTGATGCTGGAGCTCGCCTACATGCGTGATCTTCTGAGGAAGCCATCAAATCACGAAGTCGTTCCTCCTGCTGCTCTAGCTGCCCCACCTCGTTAATT
CTCTCGTACAACAGCGCGTTCTCATTTCGAAGCTCATTGTCATCTCCAGAACGTCCTCTGAGCGGTGGCAACTGCACTAACTCGTCAGAATCGACTACAG
CCTTTCGATCAGCTACTTCAAGCGTCTTCACGCGCTCCGTTTGCGCCTGTAGCTCGTCTCAAGTTGATCTATCCGGTCGTGGGGATATCTGAATCGCAAC
CGGTTTCCCCACTTGTATTTCCTGCACCACTTCTTGCACTCTTTTCGGCTTGAAGAACCATGAGACTATGCTGTGTCTTGGTTAATCGTGCTGGTAGTTC
ATACATCGAGTACTTGGCATGCATTTCTGCGTAACTTTCACCCAGTGCGTTGTACTTCTTCAGCACGCCAGTCATTGCACGTTGTTGCTGATCAGCAAAT
TCACGAAGCACGCTCTTCTCCAGAGTTTTTCCATGCGGTCAATCATCTCGTCGGCACCCTGCTTCACGTCTAGTACAAGACTCGATACTTATGAATCTGT
TCCGAGTCGTGCAACTCGCCAGACTGGATATTGGCTGGGTTCCAGCTCGTGGTGGGGTTTCCTTACGCAGTGAGTGATCGCTCCCTAACAGCCATTCATA
GCCAAAGAATGATGCACGATTTTATCATTGCTGTTCCAGCATTCCACCGCCGTCTCAACATTGTACATTCATTTAATGAATGCATTTGTGTTGGAGAATG
CAATCCAACAAGGACCAATGCAATTGTTGCACCATGCATAATTAATTATGCGCTGTGAGGACGCTGAAACCACAGGCTCGAATGGCTATACCTGCTCTAA
GAGTTCACACTGACCCAAGTTCCGCAATTGAAATGCCCCGCTTCGACGACAGGTTACCATTCGTTCCGGGGTGACTGGTAGTCTGTCGACCGCTACATAG
TGATTCGCACTCGCTATTGTAATGAAACACGATCATTTACATACCCTAGATTCGCGTTCGAGAAGACTGCAAGGCGGAAGAAAGAAGATGTTTTGAAGCA
GACAGCGATCACAGTACTTTCAGCGGATTTTAGTGTCAAATTCACCAATGCCCGAGGGTACGACAAGTCTGAAATCCAGAGGCGATACTGAATGTCGGTA
TTGTTTGATGAACTTTCGTGTTCACAAGTGTAGGAAAGTGTAATGCACTTGCGAGGGTGCTGTCAGTCCATACATTGGTAAGGTCTGTCCGTGCAGCTCT
CTCAAGTCTACTGCACGCGTGTCCTGCAGCCTGCACGCACTTCAACATTGTTCTCATGAACGCAGCATCCGCAGAGGTGACAAGTGCCCTTCGGGATAAT
GGGTTAAGTGTCAATTTTACTATCAGATGAAATATAAGTGGGCCAATTATACCAATTGTTTTTACTTTCACGAATTTCCCAATTCGAATTTCCGCGAAAA
CTTTGCGGAACACAGCACTTTTGCCTCGAAACACTCAGCCGCCAAGTTAGAAGCCAAGATGCAGATCCAGATCAAGGTACCCACGCCCCACGCCGCGATC
ACAGGGCTGGAAGGGTACTAATAGTGTGTTTATTGCGCTGGTGTAGACGCTCACTGGCCGGAAGCAGACGTCAACTTTGAGCCGGACAACACGGTACGAT
GCGATATTCTGGCGCTTCGGACGGTGTGATACTGACGTTGTTTCTCCTTCCGTGAACAGATCCTGCATGTGAGCAGGCCCTGCAGGAGAAAGAAGTATCC
AGGTGGACCAGATTCGTCTCATCTACAGTGGCAAGCAGCTGTACGTGGAGTTAGTCTTGAAACGATGAGCTAGACACGGATGTTGATGCCTTGCTGCTCT
ACAGAGCCGATGACAAAATAAAAATACTAAGTATATATAACAATTATACTAGTATAGGAATGTGCAACTACGTTTTGGATAGTGGATTAAAGTGTAAGGC
AAAGCCATCGCAAGAGCGTTGTTGGTAAGCATCCATTTTCAAAGTTTCCTTCCATATGAAATTTTCTCGCCAGAGGTCAGTGAAGATATGATGAAAAGAA
TAATTTCAGCTCCGAGGATGAAAGAATCACTTGCTTGTGTGGATCATCGATGGAGAGATGGAATTTCGCAAGCCTGCAATAAAGAAAAACATTCGAAGTG
GATTAAATCAATGCCATATCCGCAAGATCTTGGGTGGTGGGGCCCAGACTATAGCAAATGGTAAGCAGCTATCCAAGTATTATATTTTTATTTTTGATAA
ATATAAAGTTAGTAATATAGTAAGATGGCGTACTCTCCGAGCAATACGAACTTAATAAAGAGCGCATCAAGGCGCTACTATCTAAAGACAGGGAAACGCG
ACTGGCGAAGCAGCGAGAATATATGGAGCATCGACGGAAATTCGTGCTCGTAAGAAAAAAATATTCAAGCAAGTCGGAACTTAAGCAAATTAACGAAAGC
GAACTAGCTTAATTAAAAAAAATCTCGGATATAATGTAACGGTTACCTGAAGAGTGCCGTCACTCTTCCGAGTTGGGTACATGGTGTACCCAACATCACT
GACACGTTGTGGTGGCTCACAGCCACCCATACATAAAACATATAGGATAAACTATAGTTGAATTAGGAATGTATTGCAGACAATCTCTAGGTAACTAACT
ATAAATATATCAGTCTATAAACTACGTTGTCTAAGTCAACCGTTCCCCAAGACCGGGAACTAGTGAACCGCCGTTCACTTGGAGTTTGTATACTCCTAAC
ACTTCTCAAGCGCAAGGTGCTGTGTGATTCCCGTCACACTTGGTAGCACTTGTAGTCAATCCTCGCCTACGCGGGTAGGATTGGACTACCTGAATCCTCT
GTGGTCTCAAGCATTGAGCCACCA