Description :
Non Conding Region
Location :
Scaffold_1:53714- 53984
Sequence
270 bases(100 bases per row)
CCCCTTTGTTGCTGTGTGCTGTACGTGCGGCTCTCGAGCGATGGATGGCGTAGTGCGGTCAATTGAAACACCCAAATCCGGTCGAGACGGGTGCAAATAA
ATAACACAATGCCTTAATTTCGGAACGTAGATACAAGTACATTAAACGAAACGGTTATATTCGGAATGGGTGAAACAGTTGACACCCGCTCAAGCGGGGG
TGGGGTGGAAGTCACTACAAGTCCAGCACCGCATTCTCCCCTCGTTGACCTGGCCGACCTGACCCCAGCA