Description :
Non Conding Region
Location :
Scaffold_1:53460- 53594
Sequence
134 bases(100 bases per row)
CCGTGGGCAGAATTATAAGGTTGAATCATCTTCGTTTATTCATTTCCGGTGAGTTCGTCGTTCGTTAACTTGTGTCACCAGTGTTGTGTGGTGCTCACCA
GGGGCGGCAAACGGTCTACAGTTGAACTTGTGTT