Description :
Non Conding Region
Location :
Scaffold_1:53445- 54541
Sequence
1096 bases(100 bases per row)
CGGCCGTTTGAGCCAAGTGCAATCACATGTTCTGTATTTTGTTAAGAAGCGCTTTTAATTGTTCTTGTCATGTGGCCATGACGCCTCTTGCATTGGCCAT
TGCGCGGAAAAAATATGCTGCCTTGAAGTTAAACGAGCACGAGATGCAGGCCGAGCGCGTGCATCTCGCGACGCGCGGTGTGCTACATTGTACGACGCGA
TACGACATGAGCAAACTTGCTTTCAATGTACTTATTTAATGCTTCTTAACTAACCCCGACCAGATCGTCAACCAGAGGCCTATCATCCGACTCGACGGGT
GTCCCTTCTTCCTCATCGTCGCTGAGATGCACGCAATACGTGTCTTCGGTCGTGGAGGCGTGTTGTGGTCGGTTGGCCTTTATTAACGTCAAGACGACCC
ACACCGTGTAAGAGAGTACGACGAGAACGAGCAACAGGACGAGCAGTCTTCCTTCTTCTAGTAGACAAAGCTCCATTTCGCCTTAGAATATCATGGCAAC
TTGCATCTTTGCGTTGCTGCGGCGCACTCGTCATCGACGCGTCGGGGTCCTCGACGCCTTTGTCAGGTAGTACACTCGACCATGGTTCGAGCGAGCCCAC
AAGCCGGGCAGTGGCCGCCTCGCACACGATCGAGGTGGGAAACTCCGAACACCCCGAGACGCCAGCGCCAGGAACACAGTAGCGCCGACCATTGGTCGTA
CGTACCGCAGTGTACACGCGGTTCTGATTAGCGCATTGCCAGGCGGTGGTGCCACTGGAGCTCGAGTTGCTGCAGTAGGCGGCTTGAGCGACGCCGCACC
AGCTCTGGTTGAAGACGACGGGGCTGCAGTCGCCGGCTCGTAGCAAGCAAGACGGGTACGTAGCGTCCACCGTTCTGAGCGGGAGCTCGAGAGACAACGA
GAATGTGTATGCGCAAGTAGCACCGTCGGTCGAGAGGCACTCCACGTGGTCTGGGAAGCGACGCGCCAAGAGGAAGCCCGACGGTGTGGCCACCGCCTGC
CACAACGAAGCTGGTGCAGTGTCGACAAGAGTTGAATTCGTCATGATGTGAATGTCCCGGGAGAAGGAAGGTTGCGGAATGAAGATGGAGGCTGCT