Description :
Non Conding Region
Location :
Scaffold_1:53398- 53904
Sequence
506 bases(100 bases per row)
GGCACCAGTTCCAGTGATATGTGTACTGTATATAGTTGAGCTCGTTCAATAATGGCATTATTGTGGTCAAGTACTCTGTAGTACTAGTATTAATATTAAT
AGTACAGTAGTAGTTTCTTCTACTGCGTAGTACTGTAGTACTTGTAGGTACTAAGTACTTAGTACTACAGTACGTATTACACAAATATGACCAAATCGAC
GTAGTACAAGGAGTAGTACATACAGTGTACTAGTATCTCTCACCTTGGGACTTGTGTGTCAAGTTGGTGTTGATTATCAGATGGTACTTATGAGTTTTAT
TCAAATGCGTTTTACTACGTTTTATAGGTTTTATAGCAACCACTTATTGTATTAATAGTACTATGGTATTAGTAGTACCGTAGTTCTAGTACTACTACTA
TTAGCAAAGGGATAGTATTAATAGCTTACATTTTGGCACCAACCACCACATAGTACTACTAGCTACATTCTTGCGTTAAACTCACGATAGCTTCACTACC
GCATTC