Description :
Non Conding Region
Location :
Scaffold_1:53224- 54491
Sequence
1267 bases(100 bases per row)
TATACATTGACTCTGAAAATTCCGCGCGCGACTCCAGCACGTTAGCTCGCAGACAGCTGCAGCTGATCAGCGATGGTGAGCGGATCGTGGGTACACTGAC
ACACCGCTCACGCGTCATGCCAAGTACTATTACTAGTAGTACACTGTACATGTACCTTTCGTTTGTGGTACCGTACACTGTCTACTGGACCAAGGACTGA
GGCGATCGGTGTGCCACGTCCGAGATGCAATCCTTCGACAGTGGAATCCTGCCTTGCACTGCGATGAGCGCCAAATCGATAGCAGCGCGTATTAGTACCC
ACAGCCTTGTGCGGGCTTGCTTCAGGGCAGAGGCCGCCTCGGTGGGCAGGCCACCCGCGTCTGGCTCTTCATGGATGTACGCTCTTCGTGTAATAGGAGC
GCCGCCGTGCGTGTTTGTAGCGGTGGTCGCCAGCATCCACATCTCCGCGAGGAGGGGACTGACCCGCGTACCGTGTACTCCGCCGCTTCTGTCTTCTTCT
CGCAGGGATTGACGAGCGAATTGCGCTCGTGCAGCGCAGCTGCGGCGTGTCGCACAGGTCGGACACCTCAACGATTGTCCTTGCGAGTGTGAGGCTGTAA
ATGGTGTGCCTGCATACAACCATTTAGAGATCTGGGATACCACGTAAATAGTGTGCAGTTTAAAATGTCAAAAAGAGGGTCCTTGTCGGCATCGACAACA
TACATGTAGTACACGTCGTGCGACGATCGAATGGCGAATTACAGCGCACTGAAACACGAGCGTTTAATGACTCGGGTAAAGGTCCCGACGTACCAAGTAC
AGCGAAGTGACCTGGAGGATACACACGCGTAAGTCGCACCGGCCACGCCTCACGAGCGCATTCGGAAGTCCGCCATATCTTTCTACTTGCATGTAATAAC
TCATTTCAACACACATGCGTAAGTTGCGCCTCCTCACCCGCGTAATGCGTGCTACGGCGCCGTTGCTTCCGCGAGCTCCTGCAACAAAGCGGGGCAATAC
AAATGGCAGCTTTGATAGCAGCCACAGCCTGCTGCAGAACGACCGCGAGCTCGTGCAAGGCTGCGCGGTTGTTGACGCGGGACGCTTGAAGCAATCGTCC
CTCTTTTTGTCATGCTCGCGACAGGGCAAAATTACACCCAGTGGATGTGGAAAGATCGTGCAGCATTTTAAAACTCTGCATGATACACGTGCGGTTAGTA
TGTCGATTTAATTTTCCTATTTTACTCGACACCCGGCGACCCAAGCAGAATCTCGAGGTCGAGTCAT