Description :
Non Conding Region
Location :
Scaffold_1:53220- 53503
Sequence
283 bases(100 bases per row)
atcgtagcttcctgctcgacaaagcatccgagaagtatggttaacaataaaaagctaaaatattcaggatcttctcaagtaggtggatctcagggcaaac
ttaccacctcacgacgaatatcctcatcggatttggggtcccagtacgcgtagcacagcgcgatggggatgccaaagcgcagcgtgtagtcgatcagcat
tttggacaccttcatggccttttgattagtgcggacttaatgcgaacttaatgagcctcagccgcacattcgtcagaccaaaa