Description :
Non Conding Region
Location :
scaffold_1:53173- 53443
Sequence
270 bases(100 bases per row)
CACGAACACACTTCGCGCCCATTACAGCGACGTGTGTGACGCACCAGCTTCGCGTCAATGACACTTGGCGGCGCCTTGGACAGACTCTCAGCGTCGGTCG
GCATCGTCTCCTGCTCCATAGCTCTGGCGTCGCTTTAGTATGGGTTCCAATAGCAGAAGGGACAGAGCACTGCGATTCGCTAAAATTCAGCAGGCTAGGA
TTTTATGATAGTTATATGACAGCAGTATGATATGAGCCAAGCACTCGCATTTCATCATATTGGTTGGTGA