Description :
Non Conding Region
Location :
Scaffold_1:53122- 53470
Sequence
348 bases(100 bases per row)
TGCATGCGTACTGTAGCCCACGGAGTTCGATCGCTTGCGGTATTCGGAATACACTTGAGTGAGCTTGCTGAGGCAATTGATGAGCGGTAGTTGACTGATA
TGAACCACCAGTTAGGTTTTGGGGAGCCGGCGTTTCAAGATCATGTGCTGGGTATTCGCGGCACATTCCTCCACCCCACTTGAAGATCTATTCTCTGTAC
AGACACTTCAACCGCCGGTGTCCATGTTTCTCTGCTCGCATATTTCCACTGCGACATCGAGAAGCGTCAGACCAACACTTGTCCACTGTTATGCGGAGTC
CGCGAATTGAGTGCGGGAGGCCGAAGGAATCGCAACACCGCGCCAGAA