Description :
Non Conding Region
Location :
Scaffold_1:52960- 53053
Sequence
93 bases(100 bases per row)
ACTGCGCAAGCAAACTAGAACGAAATGTTTATAAACGCCGATGTAAAAAATGCAAACAAAAGTGGCTATCACTAAGCACCTTGGTGAATGCTT