Description :
Non Conding Region
Location :
Scaffold_1:52902- 53071
Sequence
169 bases(100 bases per row)
GTGATGATCGTAATGGCTGGAGCGTGAGGTGAACGAGCAAAGTGTACCGCCATCATGGTACGTTGGTGTCGCGCACACCAAACTTATCATTCTGAGGGTC
GAAGCGGTCGGACGGAGCAGCTCGATCGCCCATTATCCAAGTCTCCGCATAGCAGACAGTTGAGGTCGA