Description :
Non Conding Region
Location :
scaffold_1:52797- 53134
Sequence
337 bases(100 bases per row)
TTGGCTGCTGCTGCTGTGGATCTGCTTGGACGGGGGCTCGGAGGGGCTGGAGCTCGAGAGCTGCGCGGCTTCTTTCCTTGTTTCCCCTTTCGAAGGTTGC
GCGGTACTGGCCAATAAAGTTGAGTGTGGACCACATTTATGAAAGAAAACCAGCTCTTACAAATGGAAAGAGGTTTTACTTACAATGACGAAAAACCTCA
CAGCCTTTTTCACCATCGAAGTGACTGCTACACTACTCTTGAGACTTTATACTAAGCTTAAGAGCATCTGGTTGCTATCATTTTAAGATGAAGGAGTGAT
GATCCTTCAAGTTGCGCCAAACGACGCGCATTGTGCA