Description :
Non Conding Region
Location :
Scaffold_1:5279- 6142
Sequence
863 bases(100 bases per row)
CCGTCTGCTGGTGTTGATGTCACTGGATGCTTTCTTGCGTTACGGGTTGCAAGCGCCACCAACCAGTCCGTTCGCAAATCTTGTTGGTTGTCGTGAACGG
CCGCCTCTCTCTCTCTCGCTGAATCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNC
GCAGCCGCAGCAATGGATGGTGAGCGTGTAGACGGCTTCTTTGTGACGTCTCGAGATCTTTGTGAGCGCTGTCCTGAGGAGGAAACGCGGCGCGTGCAGG
AAGCGGCGGTCGGCAGCTCTCTCTCACTCGCCTTGCATGCACAGGGGGAATGGACTTTTGCGTCCAAACAAGGTTCCTGTGCAATTTGATCAGCAGGTTC
AAGGGTTTAATTATACCTGTTTTATTTGATAACAACAAAAAAGAACTTTTCTGTAGACACAAAGGCAATTTTGTGCCAATAACAACATGGACGAGTCGAT
GCACGCGCGCTGCGTGTACTTCCACGAGCGGCTGGTGGCGCACCCGCTCGCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGGACCCTGTGGCGA