Description :
Non Conding Region
Location :
Scaffold_1:52635- 52801
Sequence
166 bases(100 bases per row)
TATGAAAGACGCCGTGAATACTGAAAACAGGGCGAAACACGAGTGCACTTTATCCCAAAGCCGGTCACGCTCTATCTGCAACTTGGTTTTGGGCCACCCT
CTCTTGTTGCTCATCATTCTGACTGCTTGTCTGTACGTGCCACCCGTCGACCCACTGCTACTTCTC