Description :
Non Conding Region
Location :
Scaffold_1:52476- 52747
Sequence
271 bases(100 bases per row)
TTATTGACACAGAAAACCGGTATGCACGGTACTGGTAATTGGGGAGAATGGACGGGAGTGTGGTTCAAAGGCCGTTAGGATACAAAATGAGATGTCGCCC
AGAACACGTCATTCCtccccagcagcagttggggcGGTATTTTAACCAATCacacgagctcaagtcaaCATTGAAGTCACGGTAAGGTATCCGAAGCTTG
CTACGATTCGATCGCGGCACTTGGCAGGTATTTCTCCCATTGCTGCGCTTGGAGGCAACCAGATTCGGTCA