Description :
Non Conding Region
Location :
Scaffold_1:52300- 52454
Sequence
154 bases(100 bases per row)
AGATAGGCATCCCGCACCTCCCCGTGCCCCAATATTTAATCATCGTTAGTGCATCACTTTTCGTGTGCAGCGTGCATAAGCAACAACGTATTAGCAATAA
ACGCGCCACACTACCCGCCACGTACGCACTGCCGTTTCCGTTTTGAGCTCGCAT