Description :
Non Conding Region
Location :
Scaffold_1:52150- 53351
Sequence
1201 bases(100 bases per row)
CCGCCCAATAATTGCCGCGAGCGCGCGCAAACCGACCGACCTTTTGCCACTCCAAAAAGCTCCCAGCGGAAACCTCGTTTACATGATACGATATCATTAT
CGATTTCAGGAGGATAGGATCAATATACCCGTATTCGAGAAAATGCACACATTAGTTTTTTTTATTGCATAAATAGCTTGCATCTTATTTATTAAAATAA
CAGTAGATTTAAAGTATAGAAAGTATAGTAATCAATAGATGAATAGCTCAGTTTTGTGATTTACGAAATTCTCGCTCGTGCGATGCAAACAACAGCAATT
AAGGCAAATCCTGTGAAATTTTGTACATATTCTCACAGGATCTGCATTTTCACAGCGAAAATGAACAAACGAATCCCTATGAAAACACATATCATCTTAT
AGCTGAGGACCTCTGTTTGGTTATAGACTTCCAGTTGATAACGTTGTGTGAATTAGCCAATGTTGCACATCGTCGCCATAAAAAGCGAAAATATCGTGAC
GTGTCGTGACGTGTCGTTACAAGGTGAACGAGGGAACACGTTTGGGTTCAAAGGATCATACCCAAAGTGATTGAGATTGTATGATGAAGACTGGATCGGT
TTGGCCTCTCGCGGCTCTTCAGTTCATCGCACGGCGGAGCAGGATGGATGAGTAAGTTCATGTCGGTGGTCTAGTTAGCTAGACAAAGTAGTCTCGCAGC
ATAAGTCAATCCAAGCTCTATTTAGGTACTTGTAATTCGCCTTGGAAGTACTTCATTTGAGACGGCAAAAAGCAGGCTTTTTACCCCCTCCAACACTTTC
GATGGAACTCTGAGCCATCGACACTCACTCCCCTAGAATGGCCATGATCTCCCAACATGATAACAGTTTGAGCAGCAGCTCAAACTCGGCTTCTTCCAAG
CGAAATAATAGTCCAAAAGTGCCTGTCAGAGCCCATGTGCCAACTTGGTTTGCCTGACTGAAATAGCAGTTGAGTGAAGGTCTAAAAATGTATCTACTGC
CCCCTCTCGAAGTCGATTGCAACCCACATATCGTTTTTAGCAGGGCAAGATCACCCATACCAAGCAAAGGGAGCTCAGTGTCTTCCACCGAGCCAAAAGC
TAACAAAGCCCAAAAGCGAACAAAGCTCAGTCCCGAAGCTTCCTACGAAGAAGGAAGAAGCGAAGGGGGAAGAGAGAGAGAGAACTCGTCAGCAACAGGC
A