Description :
Non Conding Region
Location :
Scaffold_1:52046- 52486
Sequence
440 bases(100 bases per row)
CCTGCTTCGATGTCAGGTGACGGCAAAAGGACAACCCATTGTCACATTTGCAAAGTCAAACCCTGATACGAAAGGAGGGTCCAGTCTGGTCTCGTATACG
TTCGACGCTTTGATGAGCTCGTGGTACGTTGCTGCTTGCATCCCTCGTCCCCTCCGGTTGCAAAAGCTAAATTCCAGCTATCGATTTTTATCACAGGATG
CGGGTCGCGGATGACACCTTTTTGTACTCCGATTTCGCGTCCGCTCTGCCGACTGACGCTGTTTCTGCCAACAGTGTGCCGGTAACGAAGCTGCTCTTTC
TCGCGAGGACAAGTTGCATTCGGGAGTTTGCTGACAACCATCCTCCGAATGTCCCCAGATTGGTACGCTGCGACGACTCCAGAATGCATCAGGATACAGC
CGAATGCATCGCGGAACGGTATCGGCAATGCTGAGCAATA