Description :
Non Conding Region
Location :
Scaffold_1:51953- 52056
Sequence
103 bases(100 bases per row)
gtctcctaaatggtatgaggagctactttagattgtgattggggaaaaatacaaaaaggtatcagatggaatcagataaaagcggatccatttgagcaag
aca