Description :
Non Conding Region
Location :
Scaffold_1:51868- 51970
Sequence
102 bases(100 bases per row)
CAGCAATCGGTTTTCATTGGCTGATAAACCCATTTTAACAGCTTTTGATTTGATATATACCTAACATTTATCTACCAATGGGATAGTGCTGTTTACACAC
AG