Description :
Non Conding Region
Location :
Scaffold_1:51809- 53966
Sequence
2157 bases(100 bases per row)
ATCGCTGCTGATTCGCGTGCTTTGAGCGTCTTCTTCCCTTGACGAGAGGTGCGTCGAGGCTTGGTTTGCTGCTGCTCAGTGACTTGTCCCGCCATCACTG
CCACATTCGCTGCACTCTCCGTTGGCATCGCCTCGTGAGCATCTCTTTGCTGCGGCTCCGGTGCATTGATCATCGACGAAATGATGGCAGCGAGGCCCTC
GTTCTCGTCCGCCGCGAGCTGCTGCGCTAAGTTCTTCCGTGGACGCGTGGCGCGTTGAGGTCTCTGCTGAGAACTTGTGTCTCCTGCCGCCGCCTGCCCA
CTCAAGTCAAGTACTTGGCAGCTGTCCTGCTGTGGTGCTACCGCTGCTTCTTGTGCAGGATGTGCTGTCGTAGAAGCTGCTTTGGGTGGCGCTGGAACGC
GGGCAATCAAATCGCTGGGTGCAGCAGTAGCAACAACAACTTTCCGCTGTCCCGCAGGCTGCCTACTGGCCGCAGAAGGCGCACCACTTGCAGGAGCTTT
CTCTTTTACCGAGGCTGGCGATTCACTTCTGCGTGCGAACGCTGAGATTTGCTTCGCTGTTCGCGTGGTCACGAACTCGGCCTCAATCGCTTTCCAGTTG
GGCCCATGAATTCGATATCCGTTCCAAAACGCTTCTTTTTCTTCTGGTGTCCATATACGTAGGTTTGGACGTGGTTGCGCCACTGCTGGCGGCGGATGGG
TACGGGGCACGTTCTCCATCGGCGCATTCTTCTTACGCATGCCGCCTCGACTCGGATTGACGGGCATCGAGTGCGCGCCGATGCTGCTGCTTGGTGGTGG
CGCCGCGCATTCGTTCAGCAAAAGCAATCGTGCCCCCATGCTACCGTTACCGCTGGGTCCAATCCCGTCACCACGTGGTTGCTGCGGTTTGCTGTTCTGT
TTCCTCACCTCGTCGCGGATTGTCGCGTTCGTCGCAGGCGCATTCGTCGTCGTACTTGCGCCAAGCCACCACATCGGCGCACTGGCAGAACCAGTATTGT
TCTCCTCACGCTGCGCGCCACGAGCATCGCCACCATGTCTCGGCATGTCGGCATTGCCGTTCGCTTGATCCCAGTGGAAGCGCATGTGGGCCACTTGCTG
TGCGTGCTGGTTGTACGCATGTGCACCACCGTCTGTATGGCGCTGAGTCGAGTGTAGTGTCCGGTCGTCGTCGTCGTCGTCTTGCTCGCTGTTGAGGATG
TCGTGGATGCGCATGGTCGACGGCGACGGCGCCTCGTATCCTGCGACCGCGACGAGCGTTGGCTCGAGACACACAGCGAGTCCGCTGTCGCCGCGCGGCT
GCTGTGGGTGCGTCTGGTGGTGCACGTGCATGCGCTGGAGGCTCGCGGCCTCGCTGAGGCGCTGCTGCTGCTCCTCGGCGAGCTCCACGGCCTCGAAGAG
CGCCTTCATCTCCATGCTGTTTGACTCGTTTTCCCGCGCTCGCCTGCTTCTCGCCCATAAACAACAAACAGATAGACGGTGGGTTGGGAACTTAAACCGA
GGTCTAACGGATAGATGATGCGGTACGAACCGAGATTTGCAGATACACGTTGGTCGTACGATTCACACAAAGGCTGCACTTGTCTATCATTTATCCTTAC
GATTCACAGAATAATGGCTGCTCGGGTCATGTGCTCTTGTTATGAAACAGCCAAACGTGGAAAAGGACACGAAGCCTGTATACCACGATGCCTAACGAGA
CAAATGCTGCCGTGTGTACTCACGTACTGGCGTAAGGAGCGATACCAACTATAATCTGTAAAGTATGTAAAGCAAAGGAGAGAGAGAGATGCGGCAGCTT
CTATGACCGAGACACAGACTGAAGATGATTATCGTCTGTTCTTTTGCCAGTGGTCGGCGCCGGTTACTATCGAAATAGTTGTTGACCTAACCAGCTGCGA
CTGGCAACTGGTTAGTAAGAAAGCTAGCTGCAATTCGGTTCAGGTGACTAACCGGTTGGTACTGTTGATGGTCACCGGCCACTGGTCAGACTGGATATCC
GGACGTTGTAGTTATGTACTGAACTAAATGAATATCTCCTCCGGCTACTGTCGAAAATGTAAACTACGGACCATTTGCCTCCCTTTTTCATATGCCTATC
CAATTCCTCATCAGCGATCCAGCGAAAACGAGAGCAACACAAGAGATTGTGACAAGA