Description :
Non Conding Region
Location :
contig_1:51800- 51931
Sequence
131 bases(100 bases per row)
CTTTACGGAAGCAGGAGGGTCACCAAGGTCTCCCGCCACGGTGGATCACGATAATCGTGCAACACGAAGGCTCCACCAAGTCCTCCGCGTTTTGGTGGGC
AGACTTGAACACTTGAGGGTCACCACGTCCT