Description :
Non Conding Region
Location :
scaffold_1:51760- 51950
Sequence
190 bases(100 bases per row)
CGTCACTGGTGCAGTTTTTATTTTACTTAGGTGATAAGGTCAATCAATAGACAAAAGTTATGAGGTCGATTGAGTGTCAGAACGTCTGAGCTATGTGAAC
TAAAGTGAACTTGTCTTGCACATACCACTACTTTACTTGTCAAATTCAGTCTGGTGGGGCTTGCTGACAGGTAACCTGCCAGGCACGCTT