Description :
Non Conding Region
Location :
scaffold_1:5165- 5712
Sequence
547 bases(100 bases per row)
TCGACGTTGTGACGAAGGACAACCACAGACGAGAGCTATGAATAACTGCTGCAACGGTGTGTCAAGGTGTCAAGTCGACCACGAAGGCGGTGCTGAGTGC
TGTAGTCGAAGCACTAGCTCACTAAGCAGATGTGCCACGTACATCGTTGGCACTGCACTGTCGAGTATTTCCCGTAGTTCTTGTAGAGAATGCGATGAGG
GAACTGGAACATGTTTTTGAAGTTTCGAATGTTCAAGAACTGTAAAAGAAGGTAGGCATATGCAGAACGCCACGTGAACGTCAAAATCAACTGCCAATCC
TCTCAAACGCTGATGGCGCAAAGTAAAGTTGACACAGTGTTGGAATCCGATTATGATGATTTAATCGTCCAATCCGACTCGGATCGGACGATTAAATTAT
CATAATCGTTTACTCTTTCTCATCGTCAGAAAACAGGAAAAACGAGTCGCTCAGTTCCTTCTAGACAAATGTTTCCTTTCATTCTGCTTTTCGCCAACCC
AAACGCATCCGTGCTCTGAACATTCCTCAAGACAACCAAGACGACGA