Description :
Non Conding Region
Location :
Scaffold_1:51604- 54697
Sequence
3093 bases(100 bases per row)
AGCGGCAACCCGACGGGCGAGTCGATGCACTTAGCGTCGACNNNNNNNNNNNNTCGCTCGCCACGTCTACGAGCGGCAGGCATTCCAGAGTCCGTTTGCC
TCCATGTTCCCATCCGAGGCGCCACACTCGCCATCCAAAGCTAGCGAGAGCCGCGTGGGGACGGCCACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNTTTAGCTCGCAGCCACCACCACGGAGTAGTACGTCGTCGTCGTTCACGACCAACCGCCGAGCTTCGTGTTCGCTC
AGTCCCCTCATCTCGTTTGGAACCTCATCGACAACTCCCACTGGTTCGCCAGTCGACGGTAGTCTCTCGCTGCTGCCACGGCCTCCTCGAGGCGACCGCC
CGACACTGCTGACGATCGGCAACCTCAGCCCACGAAGCACCACGGCGCAGCATCAACGATACACAATTACTGGTGGAAGCCACAGCGCAGAAAAGGCCGC
GGCCACGCAGCACGCAGACTCGACCAACCTGTGGAAGGCACGATCGCCGCTGGCAAGACGCACCGAGTGGCAACACACACCCTAAGCGTCGCGACACTCT
ATTTTCAGCCCGAGTCTCTCCCTGAGCAAGTGAGAGACAGTGAGAGTGAGAGGAGAAACATGGACGGCAAAGAGACCATGCCGTGGATTGCGGACGCCGC
CACGACACAGCATCTTGAGACAAGCCGCAGTGCGACCCACTGGCTCTTCTCCCACTTGGTCGGCGTCCGCGGCGTGCGCATTCCGGACACGGCGCTGTTT
GATGACGAAGGCGTGCTCACCGACTGGCTCTACGCGCACTCGCCGCCGCCGTCGAAGAAACGAGTCTCGACCAGACACCACGAGACTGTAGTCCGCAGAC
GTGACGTGCTCGAGCTGAGTCTCCTGCGGCTGGAGGGTCACCTGCAGGACCTCGTCAGGGAGAAACCCGACCCAAGAGACAAGGGCAAACGGCCACCTGA
CCAGACCCAGTGCCCTCCCGTCGCGGTCATATACAACCACTCCGAGAGCGAGTCTGCGTCGCCTCGAGTGCTGAGCGAGGCAGCGCTGGACGCTGTAATC
CGCACGCTGTGTGCGAGGCAGCGCAGCCTGACGTCGCCAAAGCCGGACCTCTCGGTGGCACGCGCGTACCCAGGCGGGCGGTTTGTGCTGCAGGCTGCCG
CGATCACGCGTTCGTTGAAAACTACCACGGACGCTGCCACGATCGTCACGAGCTACCACTGCAGCGACAATGGCGCGAGCGAAGGCTTCACGCACGCCAT
GGCACCACTGGCGACGGCTTGCTGTGAGAAAGACCGGAGCGAGGCCACGCGTCGGGAGCAGTCAGAGGCTGCCCCACTCACTGACTGGTCCGCGGCATTT
GCACGAGCCGAGACGTTGGGCCGAGCCGTGGTCGCGCATCTACGCGCATGCCACGGCATCTCGATGCGTCGATTGACCCTCGAGTTTAGCTGCGGTGCAG
CTTGTGGGTTCCCTGGAGACCGACAGCTCACGCTCACGAGTGCTCGAGCCGTCGAGTGGATGCCACAGGCGAGACCAGCGAAGCAAGAGGTGAGACAAAA
GGACCTCTCGAATGACGGCATCCCAGTGCCCGTGGTGTCGTCTCGCCGCCCCACGGCGTTCCGTGTGTGCCGCCAGTGCCGCACTTCCACCGACGTTGAG
CTCGCGCGCGAACTGCAGCAGCAGCAAACGCTCGTGCGTAGCGTGCTCGCCAAGTATCAGCACCAGGGTGAGAGACTCGCCGAGGCTGAGACGCGGTGCC
GGTGGGCAGGCGACCGCAGCACGCAGCTCGAGCAGCAGCTCGTGGCATTAGAGGCAGAGAACCTGCGGCTCCGTGAACGCATCTCGATGCACACCATGGA
GACGCAGTGCGTCGATGAGGAGAAGCTCGTCATGGAGCAGCAATTAATCCACGCTCAGCAGCAGCAGCAGTGCAGTGAGCAGCAGCTCCAGGACGCGCGC
GCGCGGATCCGAGAGCTGCTGTGGCAGCAGGCGCAACAGGCGCAACATGCTGAGCACCAGGTCGCGAGCTGGCAGCGCGAGTGGGACGCACTCAACGCCC
AGCGGAATAAAGAGATCCCGCAGAGATCCTCGGGCTGCGCGACAAGCTGGAGCGGCTCATGAGTACATTCTCTGCTCTCCAGAAGCAGCTGGAGGAGACG
CGAGCAGTACGCGACGAGCTACGGTTCCAGTGGGCCTTTGTCGTGCGCAAGCTCACGGACATGGGCGATGGCGGTGTGCTGCCGCCCAGGCGCATTGCCG
GCGGCTATACGTCGTACCCGATGCCGACGCCGGCTAACGTGGAGCAAGTCGTCAAGTGGATCGTCGACTACGAGGCGCGGCGGACGGTGCTGGACGCGGG
TTTAGTGGCGAGCCCCGTCAAGTCGGCCAAGCGGCGTCTCCAAATCAAAGTCGAGCTCATGCGGCTGCTCGCGAGCGGCCCGACTTCGCTGTCATTGCCG
GTGTCCCCACGGCGACGATCACGGTCACGGTCACGGTCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTAGTCAT
ACACTCCTTCTCCCTTGCTTCTCTCACCAGTGTAACTCGGCCGGGAGGTACTTTTGCNNNNNNNNNNAGCGCAAGGCGTCTTGCAGTCCGCAGAAGAAAA
AGACGGCGAGTCCGACACGAATGGAGGTCGCGACGCTGGTCCACGATCATTTTGTCGAAGCGGTCCACGATTCCTAGTGGGAGAGACCAACCCACAAGAC
CACCCACGTGATACGTTCATGAAATATATCAAACGCGTCCCTGGGAGGCCTTCCCAGAGTTGTAGTCATACACTCCGTCTCCCTTGCCTCTCT