Description :
Non Conding Region
Location :
Scaffold_1:51230- 52307
Sequence
1077 bases(100 bases per row)
GTTTGCATTGCAGAGGCTTTGGTCGCGCATCGCGTCCGTCCAGCGTCGTTGGCCGCAGTGTAATCGTTGAACCAGATGCACAAGACTCTACCTTGCACCA
TCGTCTGGGCTGTTGGGCTTGGGCTGTTGCCAGCTGGGCAGTTGCGGTCGCTCGCTGCTGTTTAGCACCCATATGACTCGGTTCCTCTCGAGATCCTCGA
GCAGAGCTCACATGTCAATCTGCCGTGCGGACGATGAGAATATCTTCTCTTTGCAGTCATGAAGAAGGCCACCCCGCTGCATAGCCATGTGATCCCAAAC
GTTTTGCTTGAGGTGCTCTTCGTGCAGCTTGGACCGTGGCACCAGGTATGTAGTAGGTGCGGTTTTTCCCGCCTCATCGGAAGTGACGAGGTCGTGCCAC
GTCATTTCTTTACCTGAAACAGTTGGCGGCGCAATCACAACGCCGTGCAGAGCGGGTATCAACACCGCTCGATGGGATTGCTGCTTTCCGTGCGACTGAA
AAAGGAGCGCAGGATAGCATACCCCGTGCAGGAACTACATATTTAGTATCCGATAGAGTCCCGAGCAGCAGATTCGGCTTGTAAAAATTCATCACCCATC
GTCTGGCGGCGACAGACGACGACGACACATCAAGAGCTTAGCGCTCTTCTCTGGTGCGAGTTGTGCTGTGAGCTCGTGCTGTCCTGTCCAGCGCAGGAAG
ACATGGTCGCGCTGGAATTCAGTAGCAGGCTGCAGCCCTGCCTGCAAATGAAGCATTTGGCCATGTCAAATATTTTGCGACTCAGATGCCGTCAGCGACG
CGGGCAGACTCGTTGGACATGTTGACGACTCTACCGTATTCCCGTAGGCAAGTACATTGTACCCATTTCCGACATGCACACCTCTTTTCTGAAAGTCCTA
GCACGCTCCACAGCGCACGTCGCTCAATGCGATCCATTGCCATGAAAGGGAGAGCGTCGGTAGAGTGGGCAGTGTACTCATTTAGGCGAATTCGGTGGTC
AAGGTCATGTCCACTTCTGGAGCCGTGTCCAACGGCATGGACGATGTGACTCACCTGGCGTAGGTACCAGACCATTT