Description :
Non Conding Region
Location :
Scaffold_1:51122- 51643
Sequence
521 bases(100 bases per row)
GTAGAATTTGGAAATGGCCAATCTGACCAAAGTCGCAAGACGAATGAATCCACCGCAAAATGCGCGCGACGACATAGCGCAAGATCCAGTGCATTTTGAG
ATATTTTCAATGGATTGCGCGGCCTGTGATTGGTCAGGTGAAAATCCCACTTGTTTGTGATTGGCTGGTGAGGTAGACCCAAGCCCACAGTGGCGCACTG
GAATCAATTTCTACGACGACTAGGAATTCGACTATCAATAGCCCTAAATCTAAATGTGCTAACACCATTGACGCGAATGGATTTACCTGGGACCCGTCAC
TCACCAAGTCCGAGGCCCATCAATCACCTGTCTCACGAGCTGCGAGCTAGGGTTGTGGACCGTGCTCATCGAACTCATTCCTCCACACCGCAGAGATGTC
GAGTCCTTCACTGCCGTCTCAACAAGGGCGAAAATACACTGAAAATACCAGTGGGTTGCTGCTGCGAGTATGTTGCGAGCTTCGATTGTACTTGGCTATA
TTTTGAGGAACGAGACAACAT