Description :
Non Conding Region
Location :
Scaffold_1:51099- 51408
Sequence
309 bases(100 bases per row)
GCGATTCTGCTCCGATCAATTCCAAGCTGATGGCACTCGTCCAAGTAAACGGCAAAGGCACTGGAGATTGGCGGCCCGAGTGAGTCCAGCACCCCGCACG
TAGAACGTGTAGCCCCTTTCACAAGAAAAAGCAATACGTGCCACAGCAGTTAGTCTCCTAAAAATATTCCGATGGTATCGAGGAGCACCACGTTAATATT
ATTGTGACAGGTGCATTTTGTAGATCCCAGTAGTAGCAAGCCTTTCAGTCTATTCATGAGATGAGCAAAATGATCCCAAAATACGCAGTCACCAACCTAG
TTGCAATCT