Description :
Non Conding Region
Location :
scaffold_1:51096- 64759
Sequence
13663 bases(100 bases per row)
TGTGATCAGGTCTCGCGGTTACATCTCCTGATAGCGTAAAAAAAGCTGTCGTATACACCAGATCAAAATCTTTGGTGATTTTCGTACGGGATTCAGTGGC
GTTTCATTACCTCCTTGTGTTTAAGAAACTTGCATAATGATGAAGCGAAATGAAACTGATGAAGTTCCGCTACTGAGAAAAAAGCCATATGTGACTTTac
aagatgatgatgacatcAGCAGTCGAACCCAAGTGCTCATGACTACTTCAAGGTTGCATTGGCGGCTATAGAGGTACCCAGTAGCTACGGAGTAGTGATG
ACACCACCTAGATCAAAGCAAGGAAGAATTTGTGAGCAAAGAATGCAGAGCCCATAGTTGCAACCATACGTGAAATCTGCCACGGCGTCAGTATGGTGCT
GGGGCTAACGGCTGAAAACGGGTATGTGGGACTAGAAAACGCTCAGCAGCGACTTTATGTCGCTCGATTTGCTCTGGGCGAGGCAAATGCCCAAGCTAAA
CCTCCATACCAGGACGGCGAACGACCTAATTCCACCTCCGCCGTTGCCACCATGGTTATCAAGTCGATCTGTTTACCGGTTACTCAAACGTCTATGGGCC
ACTTGTTTATCCATTAAGGACCTTGAACACTTTCTTTTTTCCATATCGTTGGATGACCAATGCAAACCCTCTGCTTACCATGCCTTGATAATGCGAACTA
TCGCATCATACCCCGAGATTAAACACTTCAGTAAAATTTCACTTTCTCGTCACCAGACACAACTTGTCTATAGCAGCCTATCAGGGGCATAGAGCATCAA
CCTACACGATAGTATCTATGAGATCTTTTCTACAGCCAATATCATGGATCCTTTTCCTGAATAATACATAATTTTGTAGAAGCTGCCTCACAAAAGATAC
ACAAAGCGTTTATTACGCATATCATGCAGAATACAAGCCTCAAATCTTCAACTGGTATGTCGAACTAGGCATTCGAAGATAAAGCTAGTCTCCTAAGTCA
GCAGGCTTCCACTTCTCCATCTCACGATGCACTTTTCTTCTCGCTTGATGGCTTTGTGTGTCCTTTTGATCCTTTCCTGGCCAGCGCCAGCAAGGCGATA
AGTAACAAATGTAATGTTTGTCGTCAATGCGTATCTCGTTGGGCTAAAAAGGTCTAAGCTCATGACCTTTTTTAAATACTGGATATTCACAACACTGAAC
AATTAGAAATGAGCTACAGATTATCAGACTAATCCAAACGACCTTTGCTCTTATAAACATCGTGCAAGCAAGATCTTCGAGAACATTTAACTTTGACATG
CACGTTGTCGTCGTATGATGTAACCAAAGTGAAACAAGGCATCGAATCTTGTCAATAAATTTCAATTATTTATCAGCTGAGGATAGTTTTTTCCCTGATA
CTGCTAGCTATCCTGTGTACTCGCTGGCCACCAGACGTTCCATTTTATACATAAATACCCATTTTGATCGAGCAGTGCTAACGTAGGGCATTTATCTCTC
GCGACCTGCCTATCCTCGTGAGTCTCGGCATGCGGCCAAAGCTGAGATGAGTAAAACCAACACTCTTGAACATTCGTTTTAGACGATTGATGAGGCTTGA
TACCATGCCGGCATCGACTTGAACAAGTAGTCGGCCAAGTCATCACTCTTTTGTAAGTCCGTTTAGGGCAAAAGCACTGGCCAATCTAAAATGACTATAA
ACTTTGTGGGATTTACCCGCAGGTCCTGCTTTCAAGTGAACAACTTAGAGTTTATCATCGGAATAGGTTGTGGAAAGCCGTGAACAGCTGTGTCACCAGA
ACATTACTCGTGTATAAAGCAATTTGGCAATTTTGCCGCTCCTAGAGTACGGAGTCCTCGCCGTAGCAAGAGTAGATTGCTGTCTTTCCCCAGCAGTTGA
GGATAAATATCAACCAGGTTGAGATAACTAAAAAAGATCCGTCGACCATGCTGATCTGCAAAACATCGATGTTTGCTTTTATGCCAAACTTGTGATTGCA
CCATATTTATTAGGTATAACTCGCCACTTGCTGTTAGCCTACTTGGCTCAGAAATTGGCGCTGAGTGTGGGGATTTACTCTTTCTCATCGATTCCATTTC
GCATGTCGCATATgtaaaggcgtcaatgacatcacactgTTTACGTGAAAAGATTTGCTACCGTGTGATGAAATATTCGATTCCTGATTCAAgtcgattt
catgacgcacgcTCATATCCAGCGGTATACTCGTAGGGTACCTCTCGTCACTACGTCGTCATTTTCTTTCAGCAAAGGATAGAAAGGATCCGTTGGGCCG
GTGAGAAAAGCTGCCCCACTCTTCACGCTCAGTACTTTTCATGTGTTCCGAAtgacatttttttaatacaGATGTCGAACTCAACTCCTCTCTAGGACCC
ACCGTACCATTCTCAGAATTCACCGTTTTGCACTTTCTTGCACCAATCTGCGAAAGATATGTTCTACAGCCATAAGATCATTTACCGGAAGACGTAAGGG
CGCGCATATTGCTGTTGAAACCGCTTTCGGTTTGATATACACGAGTGGATGTTTAATCTTGTATCTTACAAGTGGAGCTGCACTGCTTTGAACGGCTAAC
TCAGCAAGTCTTAGCATATCGTGACAATAGTTAAACTTTCATTGTCTCCATGCAAGATAACTCTTTAAAGCAAATACTTTCTGACGATCTTTCTTCATTT
GCTTGGTGCCACATTCGACATGTTTACTGCAGTCCATTCACAAAATGCTAAAATAAAGCTGATTTCGTGATAAAGAGCATCCTCCGCCACATCCGCGGTA
CCACAACAAGATGCTATCACGAATTAAGTCTGGATTGAATATAACAGTTAGCGCCTTTACAGGCTATTTCTCAGTTTGTTTAATGGATTGTTTAATTCCA
CTTTCTTTGACAACACCGCAATGTGGTTTCAATCTTGGTGAAAAGGTGTTTCTAAGATCATTCGGTTTGTTTATATCATCTCGGgctcaaatttgaaaag
atCTGCACAAGATGATGCGCCATAAGCCGAGTGCGCGACGTTATGGCTAAGAGCCGGATGGCGCAGAAGCTGCACACAGATGCCGTTTTAAACTGGGTTG
TACGGTATTATGAAACTTAACTCACATGCAGTATACGTTTGAGCTGCGCTCTGAATATATCAAATGATTTATGGCGGTAGCAAAAAAGGCAACTATCTGT
ACGTTCAATAGCCCTCAGAGAATGCGAACACATTCTTTGGTTTACGTAGGCTTACTTTAGAAAATGCACGAGCTTCACATATCGAACTTTTCATAATCGG
AGCGCTCtagttttatttttttgataagCTCCTGTAGCAGAACTATCTTCTACTCTAAGGCTACAACCCGGTTTGGAAGATTTAAGCACCTCAAGCCAAA
TGGACCCGATGATATTTGTCAGTAAGTGTCGAAAATTGACGTTCACCCCCACATCTCAAACTTAGTTTATGGAGTTTATTGGCGCAAATTTGTCTAGTTC
TGGCTCAGATTCTAAATATGTTTTTTTCTAGGCATGACGCGGCTGCAATTCTGAGACATGTGTCGACCGGAGGTCGAAAAAGTCAGGTCCACGCACCTTT
TCCTGGCGGAGCATTGGTGATCCATGAAGACACCCTGCCAGAAATCAAAAGCACTTCTGTTGCGAGCCCAAAGCTGCGATAGCGCCGTGCAGAACATGTG
ATAGTCCGAAAATGATAGCAATTGTATTTTTAGGTGCCTCGAGCAAAAGTAAAAGTCAAAGCGATAATAAGCAAAGATCCAAAGATGAAACAGAAAAGAG
CGATTGCATATCGTGGTCTGCTGAGTTTAGTCTGTTGCGATGAGAAAGCACGACTGTTTTCCGTGGTACCCAGAGTGCATCATGGTAAAAATCAGCTCTG
ATATGTTGTGTCATACGTCAGAGCCAATGGAGATGAAAGCAATTGGAAGTCACAATCTTTCATGTTGACAAAGAAATTAATTGGATGACGGCATCTGTGT
CGTCCATCGTAAAGCAAGTTAAACTATAGGATTCAGAAGTCCACTAAGAccacaaaatcaaaatttcttCCCTCCTTTTTTACTTCCTTAGAAAGTCAAA
AACATAGAGCATACTTGTCAACTGCCAGCATACTACCGGAACAGGCAAACTTACGCGCAAAAGATTGCACATTGTCATGTTTCACATTTGCGCACAGACG
TATTTACCAATTTGTACCTGTCGGCCTACCAATACAATCGTTCACTAACTCGTATGTGTTTTCTCTATCAATAAATCCATTCGGGGTTACTGTAAGACTC
ATGCAAAGCTCTGTAACTTTTAGTACGTATTGGGATACGATGGGGTCTGTGCTGAAATTTATCAAGCATTGGCACGAGAAATAGCAGGATAAACATTACC
TAGAGCTAAGACAGAACAGAGTTCGACTTTACATAAAACTGCCCGGCCTTGGCTCCACGATAGAGATAAACCTGGTAAacaaggatagccatctcgtTTT
GTTTTTACTAGAAATGTGGTGACGATGTTGCTGTGCGCAATGATGCGTGTGCGATCGGAACGgcaatatcactcgctcaaAAGCTTCCTCGGTGGTACCC
GGATCTTAAAAGCGCTTGTAGTTGACCTACATCTCAGTGGCAGTTTCATATATCATCTATGCGCTCCTTGCGTTATGCAGTAGCAAGCGTCAAATTGTAA
AAATTGGCATCGGGTTGGTGACAAGCTGGTTTGCAAGCTGTGCTGAAGTCTGTGTAAAACGTTAAACACGTGGCTGTCAGATTGAAATAGTGCCTGCGCC
GCATCGGAGATTACATTGCATATGTCGGGAGTCATTAAGTTACGGTCACCGTCTATCTTCATGGTCGAAGAAACGCGGTTATCACGACAGGACTTACTCT
TGAGGCTTGATGTCTTGACTAATTTGATTTGGTCCCATATCTTGGCATAAGAATTGGCACAAAGGTTTTCTTGCTTGCACCAGCGCTCCTGTATCCCGGT
TGGACGACCAAGCCTGCATGCTAGCAGCTCCCGGTGACTGTATTCTTGCAGCACGTCGACTTAAGACATATCATGTCATTTGTaaagctcggcttgtgtC
TACGCACGATCTAGCTCCTAGCTTGAGTATTTTGCAATTTCGAACAGCATAACAGCATATCGTTTTCTTGCGGTGCGCCGGCGAGTTTGTATCATGAAAG
CGTTAAGATCCGGAGTTTGCAAATGCGCTCGTGGTGAGTACGATGCCATAAAAATCAGGCGCTGTTTCTCGGCTGCACGTTCGTATCATGATTTTGGCGG
TAAATGCTTCAGCTTGTGTCTCCTTTCGTGTAGAAACGGCCTAAATGGCTCAACGTCACATTGCTAAAGAACATGAGCTGCGCTGTGTATAAAATACAGG
CGAAGATGTCGTTAAAGCTGTGTGAACACATCTCGCGTAGTAAAAATATGCCGTATCTGGCCAACTGAAATCGTTGTCTGCTGATCGAATAAGAGACCAC
ACCGGCACTCGCCGCGATCCGGGTGATTCTTACGAGATTGAGTCGCTTGACTGAAAGCAGATATGATTTAAGATCTCTTGACGTGAAACACCCGAAGCGC
CATTCGATAACTTTGTTAAAGGTACTCTATCAACAGTGTGCAAGAAAAAGCGTAACTTTTTTCTCAAGACTGCATTCTAACCAGCAAAGTGTATCAGGTA
AGTAATTTGGGCGATCACCTAGCTATCTATCACTTTCACTTTCTTAACTTGAAAAACTATTTCAAGTGACTCCGGCAAAACAGGCTGGTGCGCCAGCTGC
CCTCTATTCACCATGGCCCGCCACTAAACGTTTTCCTCGCCGACCAGAATTTAGACCCCATTCAGCAAATCAAAATGTCTCCGGCTCCACTCGATAGTGA
GATAACGAACTTGATTTGACAGAGTCTAGGTTATGAGTCCGAAATAGGAAAGTGATAGATATAACCTAAGTGGAAGCAGAACGACGTCCCCGACAAGTAT
TAGAAGCTATCGTTATGAGCTACGCTTATCTATCACATGATAGACATCGTGTATATTTTCACGCCTGGATATGAGCGTCCTCGCAACGCTGAAAAGTGGT
TTCGTTGTGGGATGTCGGCTCATATTGCTCGGAACTATAGAGTGTCTGTGCCGCATCGGCAAAAGATACTGGGTGATCGTTCGGAAAACCGCGGGCGCTA
TAAATGTCGTAAACTCGATCTCTCCCAAGGATAAAAAGTGAGCGGTAGGGGTGGAGCTTCCTACTGGACCGTAAAAGAGTACTGTGGATACACAAAACGC
GAGCCCCGACGTGCATGATGCAGTTTTCCTGCAAGTCAGACAAAGTGCGACTTTGATTGTCCAAGAAGTAGCTGTAGACGGTTTTGAGAGACTACTGCGA
GCGTTGATTGACACTGGTGCGTCGAACAACTTTGTTCGAGAGCAAGTTGTAACTGGGCATGGTGTATGCCCAATGTGAAAAGAGGAATGACCATTCGTTG
GTGAATGGATGTAGATTGAAGATGGCAAAGCAAGCCGTTCGCTTGGCATctattttgaaaattttacAAGGTTAAAACAAGGTTATTCTTCTCGACTCcg
ataatatttttttatattagGTACGCCATGGTTGGAGCGTTATCAACTTAGCAACGACTGGATGAATATGAAAGTCGTCTTCGGCAAGTCGTGGAGCGCT
AATTCTAGCTGTATGACGACGAACGAAATGTAATGGGCGTATGCATCTGTTGAAAAAGTCGCAGATGTCCCATGTGATATTGCGGTGTGCGATGGCCTCC
TATGTCCACGGGACAAGCCCACAAAGACAAAGTAACGAAACCAACTGGATGTGGAGCAGTCAGACGCACAAAAAACACTGCCTCCTTTGCAACCGACAAG
CTCTTCACTtttctttctcttctcttctcttctcggCTTACCAATTTACCTCGAGATTGGGGATATAAACTAATATTATGTATTAAACTACCAATTGGTA
TATTATTTAATGGTAGTATGAAGAATGTGGAAATCAGACCATCCCGAGGGAAATTAAAAAAGTCATCAAAAACAATTTCCCGCCAAGTATTTCTCGTGCC
CCTAGTCAAGGTGAAAGTTGTTTTGATGAAGGAAGTGATCAAGACACTTCCGGCGCATTTGTAAAGTAGTGGCTTACGAcgaagatggtgacgtcgatGT
TATCCGTCACGTGATGATCATTATATTCCAAGTTCAGCCAAAAACAATGCCTTCTCACCGTTGTAGGCGCTGAAGCGTTGCCTGGCGAAAGGCAAAAATT
TGCAAATATGTGCGATCGTCGAAGAAGCTATTGACGATGTCATCAACCCCGCGAAAGTATTTTATGAACAGACACGGATGGAAAGGTATAATGAACAGTC
CTAGGGCGTTCTATGGACAAACTCCGTGTATGAACTTGTCAAGAAATATGCTGATATATCCCAGACAAGGTGTCAAACGAATTGTCATCTGCCAGAGGca
ttcgtcatgagattgacatacATCCAGAAATAAAGCATTGTATCACACGGCGGTTGTCGTTGCCAAAAAAATAATTCATTGCAATCAACGAGTTCTTTGC
ACAGCGTAAGAAGGCTGGTCATGTGCTGGAGAGCAAGACTTTGCATTGCAGCCCAACCATCTGTGTGTAGAGAGCCACAGGAGGTTGGCGAATCGTTTAC
AAATTAAACGGTACAACCATCCTGCCCAGACTCCGGTTTCGCGCAAAAATTTGATCCTCGATGGAATGATGTACAGTGCTGTTTTTGGTGCGATTAATCT
GGTTAGTACTTTCATCAGATACGAATGCGCGAAAATAATACACCATGAACTGCAACAAATACTTCcagtggtatgctgtggGTTGATTAGTGATGCCATA
AGATTTGAAGAACGCCCTCGCAACTTTCAACAGAATGGTCACGAATCTACTTCGTCCATTGGAAGAGTTTCCCCGAGCTACTTCGACCATATGTATGTTT
ATAGTTAGAAAACAAAAGAGAAGTCTGATCtcgatgttcatcttgatcatggTCAAGTTCTTCCAGTTGTGCGAGAGATTAAACCGTAAGCTAAACTGAA
ACAGTACGTTTTTCTTCCACCGAAGATCCCCGTTCTCGCTGCTTTCTGGGCAAGAATAACATTTGTATGGATTCGGAGAAAGTCAAAGCAATCAATGATT
GGCCTGTGTCAAACAACTGAGACGATGATTGGGCTTAGCCAATTATTTACACAAACAGACGCGCAATTATGCAGCGTTAGTACAATTCCTGACGactttt
ttaaaaagaaaattgaGTTCGAATGGTCAGAGGATCACCATGCGGTATATGCCGAAGTAAAAATGATCTTGTGAGAATCTCCAGCGCTTGCGATTGCAAA
GCACGTATAGCCTTTTAAATTGGTGTGTGATGCAATTGATTATGCCATCGGTTGAGCGTTGATGCAACATGATGATAAGGGTCAAGAGAGCGAGTTGTTT
CATATTAGTCGCGACAATATCAGAAATTATTCAATTCATGACAAAGAATCTATAGCAGTGATGTATGCTTTGGGTAAGTTTCATGTGTACTTGCTTGGAG
AGGAGCACATTGCGATCTATATAGATCATGCCCTACTGCGTACGGCAGTAAAAACCCTCATTTTTTGCGAATTATGGCTCGATGGCTTTCCTTTTTTGCG
ATGTTTAATTTGGTTATATACCACAAGCCAGACTGTACGAGCACCGTTACCGATGCGTTATCAGGATGTCAGGACTATTATTTAAAGTCCAGGAGCGAAA
ACATGCACGAGTCGTGTCGACAATGCGAAGATGTTCAGACGATCAGAGTGCAAGCAACGATTATAGTGCGCGAAGAAGTTGTCAAAGGGTACAAGTCTTA
GCAGGACATGTTGAgatatttcaaaaaatacttccgacaaagcactgcaagaTCTTCCGACTCGCACAAGATCACGTGTTCAACCTTGTGAGTACACAAT
AGATTGTTGTACTATGCGGCTGTAACGGGGGTACATCAAGAGTTGTTGTtccaaaaatgaaaatttgCGTCATCGTCTCTTACATGTGTACCATGACATG
TCCATCTGGGACGTGGGAAAACATATCTCATTCTTTCCCGAGATTACTATTAGTCACAGATGCAAAGGTGGGTGCGCAAATATGTTAGGACTTGTGAAAT
TTGCTAGAGTGAAACCATCGGGTTcactcagggccactgcggTTGTTAGTAGTGCCAGTGACAGCTGGAAGTCTGCGAGTATGTACTTTATAATCGCACC
CGCGTGACACACATGGACGCAGCGGCATCCTTGACAGATAAAAAATTCACATTCGTCGAGTCGTCGCCTGTGTCATCACGATCTTTTTCTTTATTGTCGC
CGCTGCTAATCACGTCATCACAGTAATATAGCTGACGACGCACACCTCCGATAGAACTGTAATGACAGCCTCAGCTATAACAGCAgtggactgccgtagc
tttttgcttagaggaaactaagctaaggtcaccgaccttacgttctttccaagaaccagtgcaagtgtagcggattgcaatccgctacttctaagtacta
gaGCCTTAACCGATGCAAACGaatacttctgttcaaaacggaacctgtatttaattgctttggttgcggcagagccgccaatatctaaaactcaAGGTTA
AACTAATTAACATAGTAATATCTAAttgatatagcaaaacctaattagtaTAGAAAAAACTAATTACTATAACAAAATataatcaatatagtaatatgcg
ttactactggcaatgtGGCTTCGTGtttcggtgtagccacaccactgtgctATTACACTCACTGTGTAGAACACACCTGTGTTCACCCAccctttcttac
aaaggCACGCGTAACCCCATTATAATAACTGTAAAATAGCGCTGCTCACAAACATTCTTCTAAGCACAATACACACGCTGATACGACAAGGTTTTGATTT
CCAACatggagggagaaggacagttCCGTCTTGGACAGTAGAAGAACGACTCAACACATTAACGGTAATATTGCAACCGAATTAGAATAAGTTAgtggtt
cctagctacatacAAAACACCTTAAGGGCTCCTAGAAGTTTTACTAATGAATTCGTGGTTCCTGCTTGAAAAATCAAAGGTGTGgtgaggttgaacctca
gctAAAACTTAAACAAGATCTTaagtgtacggagcttgaatcTCAAAAAGCTTGGACCTTCAACCTTCATAAAAATTGTCCAGTAGAATGGACTGGCTTG
CGCCACCCACTTCGATAGACAGAGACACTTAGGTCTCGTCAACAGTACAGACCCCCAACTGCATTCTGTATTACACAGAATATTTGGAAACACCATACTG
CAATCTTCTTTTACAGTTTCCCACTCTATACAGAAGGAACATAGATGTACCTtaatgtaatggctaagcTAAGCCCAGTACATCATCCCATTCTTGAAGT
AAAGAGTTGTGCAGGCTTATCGGAGCTGTTCAATTTCCGATCAACAATGAAGCGGGCAAGCAATTAGATATCGTTCTTCACCCAAATGGCAAGAAACAGA
TCCAGAATTCAATGACGTTTTTTCTATTTTCAACCAAAATGGAAACAAGAGACTCTACATGTAACGTTTTTTTTGTTGGCTTCGAATCAATAGTCGTGAC
GACCCAACGTTGCTCATCACAACTAAGCTTGACTTTTGGCGGACATAGATTCTCGCCACGAGAGCTAGAACAAGACGTAGCATCGCTTCGCTGATTCGGC
GCCGGCAGGACTCCCTGTCATAACCGAGCACAACCAAGCATCGGTCGTTGTAGTGTTGCCTCTAACAATACACAAGCAATTCACGCAGCTGCGGACCACG
TTGGGGATATTAGATTTTAACGCCTGACGAGGTTCCACGTGTCTGAGACCGATGGATAGTTGTGCCACCGAAGTGTTGATGGTTCAACTGCTTCTTTCCA
CGATAGCGAGTTGGTCGATTCTCGTGATCGAAAATCGTCTCAACCACCCAAACACGTTCTCCACGAGAGTCTGTTCGCGGAGGTGAGGTTGAACATGAAA
ATGATTGAGCTACTGTGGAAGTGGAAGAGCGCCTGTTGCAGGCAAATTAAACATTTCAGAAGCACCGGTCGACGCTTAAAGATCACTGTGAGAGCCTTTC
GAACCTTGTTGCAGAGCAGAATGCAAAACTCGACGCTCCTGCTGATGGTATCGCCAAATGTTTGGCTTTAAAGTCCCGTAATGAAGTACGATCTGTCAGG
CTCATGATGACTTGTTCGACTTCGGAAGCACGAAACGTTCCGTGAGATGGCTAACGATCACCTGTTGTgctctttgaagaagcaggtTCTGTTCAAGAGC
AACTTCGCGGTGAGTGCCATTCTCGCCTTCAAGCGTTAAGATTGGTATAGGGACAGTTTATAATGTCCCTTGACACTTGTTTGTCGTGAAGAatcttcaa
gatgaagtgctGGTTGCTCTTCATCAACAGCTGAAGAAACGTCAGGATTAGCTCGATCATCTACCACAGGTATAGTAGGATCGGCAGATCCACTCGGAAG
ATACGACTTTAGCCTACCCACATAAGATGCAGGATGTAGACGCATAGGTGTAGAGATGGCTAATGAATATGCCTCACCATTGCATTTCGTCACCTTGATT
GGTGCGATGAATCTTGGCAAAAGCTCACTGCTTCTCAAGTTGAACACCGCATGTTCAGGCAGATTTATCGTGCAAAGTAGTACGATATCATTTACCTCAT
ATACCTTCTTTTCTTCCTTCCGCTCTCATCTGCTTGTTTCTTTTGCAGATTCTGAGCTTTTGCAGTTGCGTCTCAAACAAACAGAACAACGGCTTGTCTC
TTCGCAATAAGGTTATCGACATGCTGATCCTCACGACTTGTGATGTCGTCTAGAGGTCTCATTTAAATAAAACTCGCTTTCAACTATGTCACAATTTGAG
GTCTGGCTGTGGCTCTATAGCCATAGCCACCCCCTGGAGACCTCGCCAATTATAGAAGCAGGCACTTTAGGAGGAATACCATAGTATATCATAAAAAGGT
ATGACCTGTCGAGACATGCGTGGAGATGTTAAACGCAAACTCTGCAAGAGGGAGAAATTCACTCCACTTTTTTAATAACGTAGCGTGACTACGCAGTACG
TCCTCCCAAACTCGATTCACACTCTCTGTTTGACCGTCCGTTGTAGGGTTTGCCGCATTTGACATGGACAATTAGTCCGAGCAGCGCATGTTTAAATTTC
AACGTGTAACGAATGTCACGGTCAGACACGGTGTCAACAGGAAGGCTAAGCAGACGGAAAACAACGTCAATAATGATTGTAGCTGTATTCTTAGCGGAGA
TCATATCCGAAATaggcgcaagatgaaccatcttgctgaatcgGTTCGCTAACAATCAGCTATTTCTCCAGTTGTCTCATATCGGACCGACATTTCTACA
AATATTACGATAGTGCACGCTAAAAGCGATTGGCTCTGTAGATAGAGGCGATGTGACCAGTAGAGCGTATTCGATAGTCAGGCTAGTAATTGCATCGACA
ACTAATGGTCGGTCGTGAATGGTATTGAAATTCGCGTTTCGTGAACTCATAATTCCAATTCGACCGGCTGCTTCGCTAGGACGGCAACGCGAAGCTTAAG
AAAACTCTGGACCCATTCTTGCTGTGAGCTTATCTTTCTAGCGCTCGTAGCGCAATGCAGGATTGTTTAGTACAATCGTTGTCAGCAAAGACAACCCACA
TGCCAGCCAGATGGCTCTAAAAATCTCGGTACTAATGCGCAAAGTGCACAATTTGGGTTGAGTATTACCAAGACGCGGGTACGGATTTGCTTTACCACGC
CTAATTTCTTGGTTGGGTGAGTGTCAAATGCAGCGTTTTGGGGCAATGATAGGAGCGCAATGTGCTAGCATGTGGCCAAATACATACGTTCGATGTTTCA
ATCAAGAACTTGATATGCAGCTCACTGACTAGCATGCTGGCAACGATGTTTATATAGTTTATGATCGAGTGACTTCCAGGTCTCAATTTAATTCGTTTTT
TTGTAAAGCCCAGATCTTTCCAAAATAGACACGAAAAAATTGACAACGAATCAAGTTGATTCGCTTTGTTGCGTTGCCATATTCCAATCAATGGACAGGC
CGAAACGGAGTCCGGCTTGGTGGTAGACAATTGTTTAGATGTAAACTCGCGATGATACCATGGATATAGACAGGCAAACGCCAGAAAAACTCTGAAGTTA
GCCATACACTCCTTGTATTTTTACAGCTTTCATTCTTATTGATTTCCAAACAATACAGCGGTCATTATCACCATGATGACATATTAATCAGGTGCATCCA
GGAACAAAGAAATCAGTCACATTCCCTTATTCTATCTCTTTGAAGTCACCTTTGACAGCTCTATATCTGCTACGCTTAAACCATCTTGAATCTACATGCC
TTGAAATGGTAATTTCGGATAGTATTGCTGCTTGCTTTTCAATATTTGTTAAATGCTTAAAAAAATCGTCTGATATATTACACGTGGGTTCAAATGTGGT
GGGTCAATGGGGTATTTCGATATTACCCCAAAGCATCATTGGGTGGTCAGATAGAAAACATCA