Description :
Non Conding Region
Location :
Scaffold_1:51028- 58847
Sequence
7819 bases(100 bases per row)
GCTAGGCGCGGCGGGCGGCCGCGCCCTCGACGCGATCCGTCGCCGGTGCGAGGCTTGCCTCGTACGCCGCCACGCAGTCCGGCACGTCTGCGAGGAGGAC
CTCTCGTGGCTCCCAGCTATCCGGCATTGGGCCCAGCCACCGCACCAAGTAGCGCCGCCGGATGGGGGTCGAACTGGCGCGGCGGCGATCGCCGCGACCC
GCGGGTGGAGCACGAGGGTCTTCGTGTTTCAGAATACGGTCAACGATATGGCGAGCATTTCCCGCTGTATCCACGAGAGGAGCCGGGCCGTCGCGTTGAA
ATCGAAGACCGTCGTTTGGTGGGAGGACGCCGCGGAGCTGCGGCGTCTTGCTCGGCGCGTGGAGGAACTGGAGCGGGAGAACCGGGACTTGCGCCATCGG
ATGCGGGAACAGAGCGACGAGCCGAGAGGGCGCTGGTACGCGGGCGCGGGGGGTTCACCGCGTCGCTAGGAATGATCGCCGGATGGTAGCGTCGAAGTCG
GCCGACGTAGAAGGTAGGGTGAAGACGGATAGCCGTAGGAAGCTGCAGTGTGTATGCGTCACCCAATACCTTTAAAATCTTGAATGGTCCAATAAATCGT
GGCGCCAACTTGTTGGTGCCCAAATTCGTCACAGATGTAGGTGTAATTCCAGTAGTCGAGAGTAATACTCGGTCGCCCACGTTAAATCGCTCCATATTCT
TACGGCCATGTTGATCGGCATATTCCTTCTGGTGATCGACTGCTGCCGCGATCGCGTCACGAACATAGCGGATAATTGAATCACGCTGGTCGATGAAAGC
TTGAGCAGCCGCGGTATCACGCGGCTGCGGCTCCGGATTGGGGTCGAAGTTCGCCGGCAGTGATTCGGCGGCTGGTGCCGAGTCTGGAGAGGGTTGAAGC
TCGACTGCTCGACGAAGCTGACGAGGATTAATCAGCGTCCGGGACGTCAATTCGGCTACTGTCGACGGTGCCGCCCTCGCGGCGGCACGGGTTTGCATGC
CCTGTTGTGCAGTACGGGACACGCGTCGTGTCAGAGCATTGGTCAAGGTAGGGCCGGCGTCGTCGACGGGATCCGCGTAGGGAATGGAGCGCTCCATCCA
CAGAAGGGCAGGGACGCGGGGGTGTCTTCCGTAGTTGATAAAAAATGGAGTGAATCCCGTCGAGGCGTGGATAGCGTTGTTGATAGCAAACTCGACCATC
GGTAGGAAAGAGCTCCAGGACTGGAACGAAGTGGCGAAACTGCGTAGAACATCTTCGACGACTCGGTTGGCCCGTTCAGTCTGGCCGTCCGTCTCAGGGT
GCGACGCGGTGGACATCTTCAACCGCGTCCCGAGGAGGAGAAACCGTTCTCGCCAGAAGGCGGCAGTGAAGCGTGGATCGCAGTCGGAGATGATCGAAGA
CGGCAGACCGTGATGTCGATAGACAATATCCAAGAAGATTGCCGCGGTCTGCTTCGCGGTGACGGTGGGGACGGTTGGAGCAAGATGGACCATCTTGCTA
AACCGGTCGACGAAGACAAGGATACTCGTACGGCCTTGTGCATCACGTGGGAGGCCGAAGACGAAGTCCATGCTGACGGACGACCACGGCGCGGTAGCCA
CTTCGAGTGGGCGAAGTGGCGCTTGCTTCGAGTGCGAGGGCTTCACGCGTTGACACGCTTCGCAGGAGCGTACCCATTTGCGCACCCATTTGTACATGTG
CGGCCAGTAGAAGTGGCGCGAGAGTACCGCGACCGTCTTCTCTCGTCCAAGATGACCACTACTGGGAGAATCGTGGAACTCGTGGATGAGACGAGCTCGG
AGGTCGTCGTCGAGCGGAACGACGATGCGTGGTAGATCGTCGCGATCGACTTGGTAAGTCAACAGATCTCCATCAAGACCGTGGCGGCCGACGCGGGAAC
GCGTACGCGTCGACAGGCGCCGCCGCGCCGAGTCGGACGGGTTTTGCAGATACTTGATTATCTCCGTGCACGCCGCGTCGGACTCGTACGCGGCCACTAT
CATGTTGCGGAGGGGGCAGCTAGCGGAGACTGCAACCGCAGCAAGTTCCTCGGCTGAGCACACGGCACACTCGTCGTCGTCCTCGTCGCCAACAGCTGCA
CATTCCACTGGTAACACCATGGTATTGATTGAATAGCTACCGCAAATCATTCAGAGCCCACCACATAAAACAAAGGTGAGCCCAGACCTTCACTAATGGA
ATTTCTGGTGTTATTGTCATTTGGATCAGATGCGGTGCTTGATTTTCCTCCCACCTTCTAGTGGTATGTAGCTTGAACTGGCTAATTTGCTGATGTGCAC
TTCAATTCCAGTGGTAGACTTTCAAGACGTCACAGCCGTTTAGGTTCTCTCCTTCTTCAGTAGTTCTGGTGGCTTTAAATGGAACATTGATCAAATATGT
CTGTTCGGCGCCAAGCAGCCCGCTAGCTCACTTCCCTCTTATCGGATGGTGATTCGAGCAAATATCGAACCAACGTCTCGTTTGACACTTAATGCACAAA
ATGATTGACCCATGCGTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAAATGTCGCACAGCGTCCCGTAATCACAA
TTTCCGGATGGAAACTTGATTGTTACAAATCCATGTGATTTTGGACCAATAGGATTGTAGACTGATGTAAAGACACGCAATTTGAAGTTTGCGCCGACCA
GAATAATCTGACCAGCTGAACTCAAATAATTGGCGTGGCTGGTCACTGCCATGCCATTGGCCAGATGACCACAACGTCACAGCGCCGCACTAAAGATGAA
ACATAAAACAGAATATGTGGAATGGTTTTCTTTACTGAATGTCGCTCACTACAGTTCAATGCTTTGAAGTTTCTCCATCCATTGTTGTCGCTCTTTGTAG
TGGGTGGCGGCTTGAAAGCCCAACAACGACCAAACCCTACAGTCGAGAATGACGAACAAGCTGGGTGGGCAGCAGGTGGTTGCAGTCAGCCACTAGCTTG
CCAGCTTGTTGTAGATCTACAACTGCGAGTTGCAGTTCGTCATCTCAAGCTGGTTGAGGTTCTAGTAGGAGTTTCTACTAGAGGCTGAACTATCACTAGG
ACGCTGGTGATAGAACTTTGGATTGCATGCATATTTCCTTTCTCACTTTACATTTTACCAAGACACAAGCAATACAATCGGCTAGACCTTAAGGAAGTCC
CAGCTTCCTCTGACGATCTTGTATCCACTACTGCGACCTACTACACTCTTGAAGCCGTAGATCGCGGTCTTCTAGTAGACGCTTGCGTTTATCTTCACTG
GTACTAAGCTTTTTGTCGATATATCCCAACTGTTTGCGAATTTTGCCAAGCAGGCGAATATTTGGGTCCGCTCTTGCACTTTGACACTAGTGGAAGATCG
ATTCAGGCAGTTCGAGCTTCACCACCACCTGGGATATGCGTAATATAATCCTGGACGTGGTCTTAGATTTCAGGAGCACAAAATACTATCGTTGTCAACC
AGGTACCTGATCTACGAAGCGCATCACGAGCGAGTTAGAAGTTATCTCTCTTCAGTTTTTTTCTCCTCATACTAAGATCTATCGAATACTGTGTTTTGGA
TGCATCCTATGCGCTGTACAACGGCTCTTAGATTCGACCGCATGCAACAGAACCGTGCGATGCGGTGCGGCCGGTTGAGAATGGGCCTAAGTGAACGTAG
TAATTGCGATAGTGTACAAACTCCAGCTGCGCACTGGAATGCAACGAACCAGGCGAACTTAAAAAACTCCTGAACGTCCTCTTGTCAGTGACGTGAAAGC
ATATTACAACCATTCGACACATACGTTAGCTGCAGCTTATCATCGGCCGCTCCGGTCACCGCAGTGTATAATAAGCTATTGAGATTTATCCAGAACACAC
CATCGGGTGCGGTTGTCGAGGTGACACAACGTCAATGAGGAGTTATTGATATTAATAACAAGAGCAGCCTAACATATTGGGAATGAGGATCGCTTTATTC
TTATCACTGAGCGCGTAGCTTAGTAGGACTACATGCTCAAATAGCAGTGATTGCGTAGCAGGTTTCCACTATTGTTGTTCCGAAGTGAAAAACACCCCGT
TTTGCACTAGCCCCAGGTTGCTAGTACACGGTCTCCCTTCCCCCTCCCAATCTCTCAGCATCAACAGACGTCGCGCTATACGCCCCCCCCCCCTACATGC
CGCTGTACGCATTCCAGTGATTTGATATGATAACCACTGCTTTCTGTTTAATACACTCGTTCAGGTTACACAAGGGCATCATGGCGGCTGGTCAGATGAA
GAGTATGCACGCGAGGCGACACTTCGCTTCACAGCAAGAAGGGAGCAGGCTAACGAGAACGCTTTGCCCATACGCTAGTATTCGGGTGGCCGCAGCGACT
TTGATTGCAGGATGGATGCATTTTTTTCCTGTAACGTCCAGTTTTCAGGTAAATTATGCGTCATACTGGCCAACGGCTTCGACAAACAAAAGGAAAGGCC
TCATCTCATGCGAAATCGCCGCCTGAATTGATCAGGTATGTATGTAGACTCACAGGATAGGTAAATCTTGTAGAAGCGTGTGTAGACGTCCAAGATGTCT
CCATCTAGAGACGTTACCATTGTTCGGTTGGCGGACAACCAATTTCGCAGCGAGTGAGCAAGCGAAATCCCTGCTACTAAAACGGCGACAGCAACTACCC
TATCACTATTTCGTTCGTATACGAAAATCATGATAACCGAAGCATATCTTCGTTCGTGGCAAGGAAAACAGTGGGCTGATAAAGGGTGAATGGTCACGCC
TCGAGCGGATGCGAAGGTCCAAGTTGAACTAAGCCAAATATCACTATACAACGTAACGATAAGTTCCTGTGCAATTGGTTAGACGTCACAAGTTGGACTT
CCAGATAAACCTCGGGAGGTGAAAACTCCCCCCCCCCCATCATCTATATTTTCTGAAAATAAATAGGCAATCCATGGGCATTTTTTTTGGCGATTCTCAA
CGTAAAATATGGAAGTTAGAAGACTTTTTCGACTTGTTTGCAACCTCCATTATGTTTTGGAGTATTTCCAAGATCAACAGCCTATACATCTTCCTGATGA
CAACAAAAATGTTAAAAAAAAAAAAAAACCTCCAATATGTTTTGGAGTATTCCCAAGATCAACAGCCTATACATCTTCCTGGTGACAACAAAAATGTTGC
TGAAGAAGGAATGACCACTGCCTGAATACATATACAAGCAGGCGGCCCGCTGAAGCGACGTATCCGCTCTAAGGGAGAAGGTGGAAGAATCAGACAAGTA
TACGCGTGTAGCAAATGCGGATTAGCCGACGGCCACAACAAAGCCTCTTGAAGATCAAAATGAGAAACTGGACTCTCTGCAATGGGCCCCTCCATTACAT
AAGTAGGTAGATTGTTTTACAAAAGTAGGTGCATCAGCACACGCTACTCGTGTGCTGAATTGTTATCATCTTATTGGCTGATATATGGGAATCCAGAGCC
ATTATTAGCCAATCAGCCGATGACATGTATTTGAGCGGCCAGGGCTGTCACGCTGGCCCTAAATAAAGTCAGAGTTGAATTTTCCTGATAATTGCGAGCT
TCCTCCTTTCTACAGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNGTGTGTATTTTGTTGTCCTGGGGATGTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTACAGGGATCGATACCCTGC
TTCTCCATTGATCATGTTACTGTGATAAAATCAGTTGGCATCAGCACTTTCCCAAATGTGCACTTCGCAGTTTGTCTGCGAAACCCGCTGACCTTGAGTA
ACACTTTTCTTTTATCCTTTATCCTTGTGCTTTATAGCTGTCAACTCACTTCCGGGATGCTTTTCTGCTTACCGGAACGGCGGTTGGACTTTAATTAATA
TTGATACCGGTGATTCGTGTGCTGCGACGACAATTCCGCTGACTATACTTTGTTTTGTGTTTTCGAGTTTGCCCACACCGAATGCCAGCTGCCGTACGAA
GCACTTTTCAAATCAGTGAAAGATTGCGCCGGGTAGTTGCACGGTTTTGAGCTGGACCCGCTGTCTGTTTGTTCGACGGTGCTTTTTACATTGCGTGCAA
AACGTTCAAGTGAAAAAGA