Description :
Non Conding Region
Location :
Scaffold_1:50979- 52461
Sequence
1482 bases(100 bases per row)
CAGACACACAGCTCAAATGCGTGCATTACAGATGGCTGCAACCAGAATTGTCACCGGTATCACTCGTGTCGCGGTAGGTGCTGGCACGGCCATTGTTCCG
TTTGCCGATGCCCTCGGAGGAGCTTTGATGGCCTCAGTTATCAATGGATCCGCCAAGGGTAAGGCGATGCGTCAGCGGTTGGATGCTACCGCTTGCATTC
TCATTAGCTGCTCGAAAGACGAATCATTCGCGGTAAGTGGCAGCCAGCCTATCGCACTCGAATTCCGCACATGATGACAGTGGTGATTCCTCTTCAGCTC
GACGATCATGCGTGGGTAgACCAGCTCTTCGAATCCTTACTCGACGCGAGTGCTTCCCACAGTGTTCATGCACTCACTGTACTCGAATGCCTTGTGCGTG
AAAACGACAAGATCCGAGCATACGCTTCAAAGATGTGTGCCTCATCCCAAGAAATTATCGGACATATTGTGCACAGTTCGCTCACGTCGTGGCCGATTTT
TGCTGAAGATATGGATGCTGTACTTCTCGTTCTTGTGATTCTGAGCATTTTGCTCCCAGATCAAGTACTGCGCTCATCCGTAGATATCGCCGTCATGACA
GAAACGATTTCGACGCTTCGCCAAAATGCAATGTCCGATGACCAGTCGGAATTAGTGGAAGCATGCGATGACGTGCTGGAAGCTTTGTCCGAGTAAATGG
AACAGGTCACTTGGAGTTCGTGTGATTATGACTTGTGTGAAAGGATACAAACTCTCCGTTCTCATCCCATTGACACGGTACCCAGTACAATCCATTTGCC
CACACAACTGGATCATCAGCAATACTGTCCATGAGGAGTCCTGTTTTCCCATACACTTGTACCCGCGGACGTGTGGTACATGTATGATGCTTTGCCGCAG
CTATCCCAAGAAAGtACTTTGATCCTGCACATCGCCATCAGAAGCGATAAAGCATTGTGAAGCTTTGTGCACATACCTTCTCGACACTTTAGAGAAAACG
CTTGGAATAAACAGTTTCCAAGTGAGCTTAAGCCGTGGAAGTCCACATCCTCTGACTGTGCTGTAGGTCCATGCCTCCAGTATGTGCATCCATCCTGACA
TCCCAGTTAATTGGTCAGCTAAAaTATTGTCAGCATTAGCATTGAGACAAACCTGTTGATCTTCAACGCGCAACATAGCATCAATTGGTTGGTGTGTGCC
AACGTGTGAGAAGAATATTAGATACTGCTTCATGTCCGTAACGAAGGGGCAAAGTAGAATCAGCGCACGACTCGGTGCTGACGGTGCAGCATTCCACGGC
ACAACAACTGtCGTTTGATACGGAACAAAACCTTCAGCACTAGCGTATAGAGTGTATACACCCGGCCTCAGCTGGTGATGCGACAATGTATTGAGCGGTA
TTGTGTAGATACCGAGGGCTCTTGCTtCCGTTTCGTCTGTAGGTCGTGTGACAGCACGAGAATCGCCTTGAGCCACAATCTC