Description :
Non Conding Region
Location :
Scaffold_1:5086- 7294
Sequence
2208 bases(100 bases per row)
GTGGACGAAAAAGTAAAGGAGACGAAGAAACGAGGGTAGACTGCGACCTTGGAGGCGTGCGGGAGGCTCACGTGGTGCTCCAAGCGAAGAGAATTCGAAT
ATGACGGAGCTCCTCCCTTGTCCGCTTTCGCTGCCGTCGAGAGAGCGTTCGGTGCGCCGCGTGCGTAACGAGCGGCGCATCACAGTGGAGAGCGTGCGAT
GGAGAGGAGCAGAGTGCAAATGGACAACGGCGCAACAGCGTCGGGACTACTTGACCACTTGCACTGATGCAATAGATACTTTTGGAGCTGGCGTCGCTGC
TTTGCAAGTAAAGTGCTGGTCATCTTTCCTTTTTAAAACGCGTATTATGCTTGTTCTTGTGGTTTTTGATATTTTGACTGTATAAGTATGCATATTATTT
GATTGGTAGGAATCATGAAATATTTTTAAATCCGATAATTGTTCCTGATATTTTCCATGTCACCAGCTGGAGACCACCAACTACTGGTCATAGTCAGAAC
GGCCGGTCTCTTGCACGACAGTTTGCTCTACAGGGTGGAATGTGAACCTTGTAAACTGCTCTTAATAGTATCACTCCTATAATACATACTCTGTTATAAT
AAATATTCATGAATAGAACAAAATTGTTATTTACAACACATTTTACCCTTCATAATATTTTATTATTGTCATAATCGTTGAAACGCAGCATTTCGCCCAT
AGTGGTACGATCGGGAACTTTATGAGACCGCTCTCTGAAGAATGTAAAAACTACCTCAGCAGCTGGTGGATACCGTGCGTGGGTGGTGGCTTCACATGCG
CATTTCACACAACAACATCAGCAGCACTCCTGCTTCTTGCGTTGTAGCGCTTCAAGTGTACGGTCCGCGACAACACCCAAGTCCCCTCCCCACCGTATTC
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACTATAATATCGCACTTATGTACTCCGTCGTACAATGTGCGTTGAAGAAACTCACACTCTGAGATGG
CCGCGAAATGTAAAGGCCCGCCTTCTAAACTGGATGGCGATTTAGTCTGTTAGTCACGCACGCCGATGCTGTAGACGCTCCATGGAGTGCTGCATTGGTA
GAATGCGGTTCAGCGGTTCACTTTTCTACGTTGCAGTTATTACAATTCGAACGACCAAAACGTGGTTTGCATGCAGTCGGCAGGTTGTTGTTGCCATGCG
GAATCGGGCCATGCGGTCGAAAGGCAGCCGCTGGGCTGAGCAACTTGGCGTGTGAGAAACATTACAGTGGCGATCACGGCGTTAGCAACAGCTGGCACCG
AGCAAACAAACAGATCCGCACTTTTGCCAAGATGCGAATGGAGGGCTCTCTCTCTCTCGTGAGGGGGTTGCTGTTGTTGATATGGACCACGAATCAGTAA
TATGATGCAATATTGTTTTCACGTTGATATAGGTGACGATGATTCGAAACTCCAATATGCTGTTGCAGTTGAGGGGCGTGTTCGAGGCTTCTGGAAGACG
ATAAAGCAACTTCAACTTGGACACCTGGCTGATCTCTGTGTGTCTTGTTAAGACTCGGGATGCTGAAAACGCGTTCGTTGTCTACAGTACGACACTTCCT
GAACGTGCGCCACCGAGTACTGTGCATCGTCGTCCCCATTTTGAGACTCATCCGGAGATTGCGCTGCGTGCACTCCTTCCACAGCTGCTGTCGTTTGGTG
TCGGAGCCACCGTTGTGCCTACATTCGTCACTGTCCAAGTCGACGGCCTGCGCACCAATATGTTGCGGTCGTCCACACGCTCGCTGCAAACGGCATCAGG
CGGAAACCTCGTGGCCGAAGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTCCTCGCTGCTCTCCATGCCGCATGAACATGTGCGCTCTACACAAAT
GTGACCATGCGACTGGTCGTACCAGCTCCGTCTGATGCAATCTACTTTGAGAGGTTATTTAAAGTCAGTAGTGTCTGAAGACAGAGGATAGACAACGCAT
TGACTCTCTCATGAACATCAGTATCCAAGCGATTGTGGCCGCTTGAAGCGAAGCGAAACACGCTCGTAGGCAAGGCAAAGCAGAATTTTTCATCACGTAT
ATTTTGTTGTTCTCATAGCGAAAGAAAGAGAGATGCGTCGTGGTTACTGTAGCTGCTTCACATCCACGCACGCGCGCGGAAGTGCAAGGCGATTATGGCG
TCGCAATC