Description :
Non Conding Region
Location :
Scaffold_1:50698- 51977
Sequence
1279 bases(100 bases per row)
GTTGTGCCAATCAAAGTGTGACGCAAAATAACCAAAATACAGTACCTATCGCTGTTCATTTGATTAAAGTAtggcaagttgaagtgtaCAGTTGACATCG
CAATAACCCATTCGTCTGCCAGATACGAAAGTCATGGAGAACCACTACGACATGCTGCAAGTGCCGCGGCGCGCCACTGCCCAGGAGATCAAGAAACCTT
TTCGCCTCCTTGCGGTGACATCCCGACAAGCACAAGCAGAATGGCGTTTCCGAGTCGGAGGCCAAGCTACGCTTTCAGCAGATCAAAACCTCCTACGAGG
TGCTAAAAGCCGTGCTCGAGCAAAAAGAAGAACGATATGTCACCCGCGCACGCAAGAGAACCCGATACGGTAGTCGTGGTGAGGCGAATAGAGCAGAACA
CGCAACTCGCTAGTGCGATCAAATATTTGCCGCGGTGGAGCGTGACACCCAGCAGGTTCTCCAGGAAATGGAGCGTCGCCTTCAAAgggagctcgagaag
attAGACGTCGATTCCAACGCAGGGAGGAGATAAATCGTAAGTTCTtgcaggagatggaggatCTAGTGCGTCAACGAGATCGGGTGATGAAAGAATGCA
TCAACAAGAGCGGCGGACGAAATTAGCGGTGAACGTCGTAGGTGGGGTGCCGTGGCAGGCGAAGTGCTCTTCTTGAAGTTTGCATTGTACCTGCTCGCAA
CCTGTTCACCTAGTGTGCGTACTATACCCACCTATTCCGAGCATCGCAGGCAGGTAGGTCTCCAAAACTAGCACAAGCTGCTTTTCGGTTCATTTGATTT
CAGTACCGACAAACTTTGAATGAAAAAGTTGAAGTTTGAAAACTGCGCCAATTCACTTTGGAATTTGCCGCCTCCGTCCCAGGACACCTCCTATCCGATA
CGGTAGGAGTCCTACCTTCAAGGCATGGTGAATCACTACGAGGTCCTGCACGTGGCGCAAGGTACTAGTCCCttggagatcaagaaggctTTCACTGCGC
TGACACCCGGAAAACCGAATGGAGCCTCGAAAGAGAAAGCCACTCGACGCTTCCAGTTGATACAACACGCCTACGAGGTGTTGGCTGACGTCAACAATAG
GAGCATCTACGACGGGCGCTTGGAGAGAGCCAAGAGCAGAAGCCAAACTGAATCTCCATGAATGTATTGCTTTATTCTGGAATACACTACGAATATTGTT
TTCCGTGGCAATCTCTGATTCTGAGTCCGCTCTCTGATACCAGTCTTTGTATCAGCCGAGTATAGCAAATTGATCACCA