Description :
Non Conding Region
Location :
Scaffold_1:50517- 50600
Sequence
83 bases(100 bases per row)
AAGATTTGGAAAATAAGATGGGATAAGGTTAATTGGAGGATACGCTCGCGGCGCGCGATGCGTGAAGAGTGATGCGAGTCGTC