Description :
Non Conding Region
Location :
scaffold_1:50425- 50750
Sequence
325 bases(100 bases per row)
TTAGACAGGTATCGGGTGTTGCGTGGGGTGAAGAGTGCGAGTGGCGCCGAAAGCTTCGCGATGTGAGCAGCTCAGGAAACTTCTTGCAGTGGAGACTCGT
CCTCAGCGTCCAATTTTTGATGTTGCGCAAACGGTGAACGTGTTTGTGACGTGGCTGTGCAGGTTGCGTAGTAGGTGATGCACACTAAATTGTGTACGGC
ACACCAATATATGTACGATCAGAGATCTGTACTAAAAAAAAGCAAACAGGGAAATACATTCCTTATCTCCCTGTGGTCCTCCTGCGTTCGTCCGTTACTG
TCTACCTCGTCGATCCTGGTTGAAT