Description :
Non Conding Region
Location :
Scaffold_1:50396- 51628
Sequence
1232 bases(100 bases per row)
TTTGCGCGCGTTCTCGGTTCTCAGCCCAGCTTTTCTCAAAATGGCAGCCCACAGGGGCAGACTGGGACCTTGTGGTGGGCAAATCAAGGACACGATGAGG
AGCAAGAGACAAACATGTGCAATGATCGGCGCCATCTGGCGAGGTGGACAGTTCATTGATGGCTCAGAAATGGAGAGAATTCAACCAGCCGATGGCATTA
AGCATCGCCCTCTTCCGCAAACGGAGGTGACGGGATGGTCGCGAGGGCTTTGAGAGTGGATTACACACTCTATGGGACATTCTGGTGTCGAAAAAATGGC
TTCAGTTGATGTGGCGCAGCCATATTATTACTGCCATTGCGCATACTGAGACTGAGATCGTTGGCGCCAGAGACGAGAGTACAGCCATTTCCACCCTGCC
ACAACCCTCGCACATGGTCTCTCCTCTCTCTCTTCCACAGTGTTGGCTGAGCTCTCTGCTTGCAGCCCATGCGTCTGTTTGTTTATCGCCTGCTGCCAAT
GCACACTCTCCAATCTGAAACTACAGGACAACGCCGTAGTACGAACAAACCCTCACGAACCTGACCTCATGGCTCGCGGAAGCGNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNTCTGCTCGACGGCGACATCGTCAAGCGCGAGCGCACCGCAGGCGAGACAGTGGACCTCTTCTTGGCCAAGCTCGTCGACGCGTT
CAACTTCCAGATCCAGGAGAGCTGCCTAGAAGCAGAACGAGAGGCGGCTATCGCTCGAAACACAAGTGACGCGTACATCGCCCACGTCAGCTCACGAGAT
GGAGCGGCCCTAAGTCAGCAACAGGAGAAGCAGGTGAATCCGTTTATGCGAAGCGTGAGCGAAAAACTCACAGCGTTCCTGTTGAACGCGTCGATCGACG
ACACGCTCCAAGAACGCCCCATGGAGCTAGGTATCAACAGCAAGCAAATGCCGCCAGAACGCTCGTCGTTCTCGTGGCTGGACCGCGTCACGCGCTCATC
CGAAGTCGATCTTCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAGGACGACGACGTGTTTTTTTGCACCGACGACGAGTCCGAAATGC
TCGCAAACTACGAGACCATGGCGTACACTCCACAAGCACGCCGCACTGGCACGAAAGCCTAGAAACGTATCGGTTTAAGTATAAAGCAGCAATAAATGAA
ACGTGCTCATTACCCAGCCACTCTTACACGTT