Description :
Non Conding Region
Location :
Scaffold_1:50289- 50445
Sequence
156 bases(100 bases per row)
ttgatccagaactgaaaaacgtggcgacataatgagaacgtacccaactaatggtacaggaatgagccatgtaccgttataatggtacaggtacgtcacc
ggcttcattagtcatttcccattagcgctgattgacacctctgcacttggacgtga