Description :
Non Conding Region
Location :
Scaffold_1:50007- 50539
Sequence
532 bases(100 bases per row)
ACAATGCATCTTATGCGTCTCTCAGGACCGGGATTTCAATTCTGAATAGTGCTGCATGAAGCCGAAAGGTTGGCCATTCTTCTGATTATTTAATTGGCTT
GAATTGACTTCAGCTGTTAACGTTCATTTACTTCGATTTCCATCAAGCAAAATAATTGGGACGGTTGATGATAGTGCACGGTTTAAGCTTAAAATATGTA
TGCTGGTTATTCTTATTTTCTCGTGATTGGATTGGCTATTCGAAACATGAAACAATTCCATTGGCCAATGAGTGCACCTTAAACTGGCCATCTACGTTAC
TTCACCATTACCCGATCAAGAATAATTCCCTCATCAAAACAGGTCACTGTTGTTTTGACCCGAAATCTGGAAATATTACATCCGGATACATCTTTTCTCC
GGTAGCCCTGTAACCTGGGACAACTGTCCAACCCCCGGAGTACAGTGTGTACATACGATGCTAAATCTCGGGGGTTAACTGCATCGCTAGTGGTTAGCTA
TCGCTAATCACTGAGTATGAAATAGATGATAC