Description :
Non Conding Region
Location :
Scaffold_1:49939- 50285
Sequence
346 bases(100 bases per row)
ATGCCTGCTCTCCAAGGATATGAACGCCCACCCACCGTCGACGACCGCTCAGCGCCGCCGCTTTTTGGTCTGTGCGGTTTTCTCTCACAATGGCGGAACG
ATGGGCTTTTTACGTCTCAACTGTTGTGATTCATAATACTGGAATAGAGAATATTATTCCAAATTTAAATCTACCCAAAAATACCTGTTTTCCTCATAAA
ACCTATCTTACAATATGTTTTAATCACCTCTCAATTACGTCGCGGTTAGGGAACTGCGAGCCAGTTGGATCTCATTCATCTGATTAGTGTAAATTCGTGT
TccttttcagccaatcgaACTCGCCATATTCAAACTTCCCGCGTAA