Description :
Non Conding Region
Location :
Scaffold_1:49898- 50459
Sequence
561 bases(100 bases per row)
AGACGTGACGTCAACCGAGGTTGTCTTTCCAGGTGTAGCTACCAGGTGCAGTCACAGGCGTGGTACAGGCCGTATGACTCTGGCCCGAAATTCAGTCGCT
GACGCCCTCGTAGCCTGCCACGTAGTGGACAGAGGTCCCGCAAATAATTAGTCACAGCGCAATGGAGAGAAGGACGAGCGCAGACTCGACGCGCATCGAT
TGCACGCTGTGCAGCTCCGGGACGAGATCTCTGAATTGCTGCTTGGACACAGGCTTGGACAGCTTGAACCGGTACCGGTACCGGTACACCGACGCGGCAA
CTGCACCGTGGTCGATTGTGAAAATTTCGGACACGGTGCTTGTCTGCTACGCGGGCTTCGTGCGAAGCCAGACTGGAGAAGGATGTACCCACATCTGGAA
GCTCGCAGCACCTCGATTTGTTCGTGACCGAATCGCATAATCAGTACAGATTGCTGCTGTCTATACCACTCCCCTGTTCAGAAAAAAGACATGTGTACTT
ATATAAGCGAATTCCACGACGCGCCTAATGACACCGGACCTTTCTGCACTTTTCCCATTTG