Description :
Non Conding Region
Location :
contig_1:49581- 50505
Sequence
924 bases(100 bases per row)
GTTGCTACCGCCGCTTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGACAGGTGGGGGCAGTCTGCACGCGCAACATGCGTTG
CAGACGTGTTTGGGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGTATTCCATACGAACGTGTTAGTCGGTCGTTGGACG
GACTACAAAGTGCTACCAGGTGTAATGGGTCTGCTTAGACCCACTACTTAAGCTTACACGTGTGCGCACGTGTATGAGGAAGCGTAGGAGTAATTTACTT
AAGTTCAGTATACTTGTATCCACAAGTATACTTAAACCTAGATAAATGAACCAAACGGAAGCTTTGGTGGTAAATGAGAACTGTATTGATTGTAAATGGG
GTTTCCTCCTAAAACTGATATTTCTAATGAGAGGTTCTGCCATTGGATGGCTGGCAGAACCCCTATCTATTGAATGACTCTCATTGGTAGGAAGGTGTTA
CTTTCTACCAGTCATATGCCTTTTGCTGTGAATGTGGACCACCCTGTGGTGGTCACCTGAATGTATCCCTTAGTGCATGTTGCACTAAGGTAGGAGGTGA
ACCGAATGTGTAGCCCCGCTACACCCGTCGTCGGAAATGGCAGCGAAGCCAAGCCATTCGTCGTGGGCATCAGCACGAAAAAGCTCCTGCGGCAAGCGGA
CCGCGATCCTAGCAGTTTCGTGCTCCATATTGACGCCACCTACAAGCTGACAGGTCGGCTACCGGTCGTCGTTGTGGGCGTGTCCGATCGCGCGCGCCGC
TTCCACCTTCTCGCTATTTTTATAGTGTCGCAACAGAAGGAGCCCCAGTTCACTGAGGTGCTGTCTTTGCTCGCTCAGATCTTCCTCACTGTGACTGGGA
AGCCACTGCGCGTGCGGTGGGCAA