Description :
Non Conding Region
Location :
Scaffold_1:49539- 49729
Sequence
190 bases(100 bases per row)
CTGATCCACAAAAAATGGAGTTGGCTTTGGAGAAACTACACTGGTACACACTAAAGCATAGTTAACTCTACAATAACAGTTTATCAAGGACCTCTAGTAC
TTGATCATCAGCTCTCAGAGAGAGAACTGGTACAGTGTACCTCTATGCTAAGAGGAGTACCGTGACATGCATTAACGGGGCAAGAAGAGA