Description :
Non Conding Region
Location :
Scaffold_1:49432- 51790
Sequence
2358 bases(100 bases per row)
GATGCGTGCCAGAATTGACAAGCAAATGAGACCTTGGTCGGATACTATCCGACGGATAAAGAGAATGCCTGTGTTTTGGCGTGCTTCCTCTAAATACCAC
AACTGCAAACTAGTGGTTGACTACACGCAGGGTGAATGCGCGCGAGAATAAGGTGCTGATCATGAAGCCGCAGCTAAAGCTACTCGTCGCGAAAGTGAAG
AAGAATATAAACAGCAGCTTGACGTCTGATTTGGGAAAAGTAACCCGTGTGCCCCTAGCGTTTGGAGTATTGCTCCTAGCAGTAAAATTGGCACGTAAGC
AAGCACCCAACCAGCAAGAAGTTTGCCATTCTGGGCTCCAAGGATACACATGAGCTCTCGAGACCTCGTTTCCTTTTCCATGAGAAAGGACACGATGACA
CGCGAGACGAGGTACAGGTAAGAGAGAACGAAGCCTATAGGGAATACCAACGCAACCTTACCGAAGAATGGTGCATAGCGAAATGCTTGTGTAGGAATTC
CATAGACGGCTGCACCGTGGAAAGACTGGGGTGCAATGCGCAGCGGTACCAAAAGCGTTTCTACACTCAATGGTGGAATGGTGTCCACGGAGACATTCGG
AAGGCTCACGGAAGCCATTTCAGTGATCAAGTCCTGGACGGTGCTCAGCAATGTGAAAGCTGTGCCGATGAGCATATCATTCTCCGCAGTCGGCGGACAT
TTTCTGTCTGCTGGCGGACTTGACACGTTCCACCAGTTGAATCTTAGCTGTACATTCCACGCCGGCATGCAATTGAGAAAGCGTGTTAACAATGTCTACA
GAGTCATGAACGTCTGCGCATTTATCATCCACAGGGATCGATAGTAGTCGTCCAGTTAATATCGGACATGCTTGCAACAGGGCAATTATTATCGATGAAT
AGCACTAATAGTATTACTAAAATTACTATACGACTAGTATAACAATTATATGGCATTGACTTTAGTAGAACTAAACGCTTTAGTCGTGTGTATTTTGAAT
AATATACTAATAGTATTCCGTATTAATATACGACTAGTTGCATGAAGGCTTTTGGGATGGATACAACGGATGGGCTACCGTTTACATTAATTTGTTGATT
TCTGTCGCACTGCTGAAGTGCGCTAAGACCGATTGTTGCTTGAAGATTTGGAGGAAATGCCCCCCTGCTGTATTGTGATTGCGGGCTGTCTCCAGTAACG
ATTATTGCAGTAAAGCAGAACTACATGTATTAACATACGACTAGCATAATGAATCTGATAAGCGCGTTTATTAAAGCAACATTAACCTAGGTTTTGCACT
GTGACGACGGTGATTCCCAAAGAGCTGACAGACACCGAGTAGCACGCCAAAAATCTCTGTTCTAGTCACGCTACAGTGATCAATCAGACATCAACTGAAT
GGCGAAGCTCTATACCACCGATGACATTGAATATAAGAAGCCTGGTGAAGCTAGCAATGCGCAACAGAGAATAAAAGACTGTTTTTAAAGTAGAGCCGCT
CTGTCAAAACAGTGAAGTTCTTCTACAGCATTTCATATTTTCAGCTGGGTTCTTCGTCATAAGTTTACTGAGAACGCGTGCAAATAACGAGATCAGCATT
ATGCCATAGTCGTGCTGAGATTAAACGGATAAAGTGAGCAAATGCCAATGTTGATTTAGAACTAATAGTATTGATAGTTAGTACTATTTCTATACCATCG
CTCCGTTTTGGTACATGTAATAATACTAAATACGAGCGAAGGAGACAAGTACCGTACATGTTGAGCATATCGATTAGCATGCGCGACAATACTACGCCCA
ATATATCATTTGTCACATTTAAGATCAATCCAAATCGATACTGAATGATACTTCAGAGCAAAAGCGACAACCAAACATCGCCGTTGCTTTCGCAAGATGG
CTTCCTGCTATGGGTGACGCCAAGCAGTGTCACTTGGTTAACGTATGGCGACAAGCTCAAGTCGTGCATAGCAACGTTGAATTTTCGCGCCGGCTCTGTG
CGGTGTACCGCCGACAAGAATGACAAATGGGTAAGAAAGCCATTAACAGCATCAGGGGTGGCGTCTGCGAGGGCATGGTGGTCGGTGTTTCATACCAATG
CGAGTGACCCACGGGTTATGAGTGACCACCATTTTCAATATCCTATCCGTTCGTGTGGCGCCGCGTTCCTGCCTTTCAGCCTGCCCGTTTCGAGCGCCCA
TTTATTTGATGACAATGTACCCATTTATGAGTATTCAATACTGCGCCATCTTTTTTTTATTTCCGCCAATAATATTGCGAAAGGCGGTGAGCGACCGTTG
TCACGGGGCTCGATTCACCTTGAATCGCCATTTACCGAAAGACCTGCTCCAGCGCAGA