Description :
Non Conding Region
Location :
Scaffold_1:49389- 49787
Sequence
398 bases(100 bases per row)
attgatacacggggcggtggacggcggggagaccagcaatggatagaggagacaagggccttgcagtggaagctgggccctcaattgggggcgcgctagg
gacgacgaacgagaagcgccaagcgacgggatggcacacgatgcgaatcaagagcaaaagtcggatcgctcaaggggggaacgaaaaaaaaacagaaccc
gggtcgattgtttagcttggtaattgtatagaaacgggtttcgacccgaaatctttggatcagtgcgtagcttttggttattcactcagtgctagaggtt
gagagctgatgtacgaatgcagaacactacgtgcatgtagttgctgattaatctagacaggttctgtagcaatgcgtgtgtactgcaatgatttattg