Description :
Non Conding Region
Location :
Scaffold_1:49356- 50037
Sequence
681 bases(100 bases per row)
GTGCTTTGGCAGTCTCTTTTAACGATGTAAGTTGCCCATTCTCCATTTTTTCCTTGTCAGTCACGTTTGAGAAGTCGCTAGGGAGAAACTTGGCTGCGAC
CAGCGGAGGCATCCGTCAGCGGAAACAAttgagtacatgtactgtaggTCGTTTGTTTGCACTGTGGTCAATCGACACAAAGGTGACGCGAGCTACAGGG
GCCAAGCAGAAAACACGACAACTTGGGACCGCTGTCAACAACAGCGGACTCAATTCTGTATCCATACAGAAGCAAATTGCCGTAGCTGTAACTTTGCCGC
GATGTAACTCGCGGGTGAAAACGCTCGGCGCTCAACGAATCAACCCTAAAGCATCTTCATTTCCTTCCCGAATCATTGGTTCCGTGGCGATAGGAGCGAG
TCCCATCGGGGTCAGCAGTGAACGACTGGCACTGCGAAGtcgcagtacatgtacccatTGCATAGGTGCAACCAAACACCTGGCCAATACAATTGCATTG
TCGTCACGTTTGACTAACATCCGCAGTCAAATCATATTTCGCGTGTCATCGTGAGTGATCCAAAGTGTAACTAGATAAAAAGACCACGCCCCAGTCAAAC
TTGCTGCTTTTCATTGTATTCTTGCTTCTTGCGACGCGTGACAAATATATATCGCGAGCGCACTGCTCCAACAAGTGCCCT