Description :
Non Conding Region
Location :
Scaffold_1:49257- 73880
Sequence
24623 bases(100 bases per row)
CTAGAGGCACTCTCGGTGATACTGGGTGTGGAGCCAAGATGCTTGATGTGTCAGTAGTGGATTCTGATGTGAATTGCTGTCTCTGACTCACGTGGATACT
GTGAGGTGTGACTGTTCACTGAGCAAGGGTGGCAAAAACCCGATTTGTTTTGCGAACTCATCGGGGTTTTGGTTTAACCTAAAACACCCGATTTTCGGAC
AAGGTTTTTTTTGGTTTTATTAATCACTTTCGCTCGGGTCGCCTTCTTCATCCGATGGATAGTACTCCGCGGTCTGCATGTCGTGGATGTAACGGGGTGG
CTCCGTTACATGATAATTTACATAAGGTAATTATCAAGTATGAATATTATGTTAGGACAAACACAATATTCTCATAATATTATCCGAATAGATAATATTG
CCTCGTAGATGTAATACACTGCTCATTTTGGTTGATATAGGATCGAGATATCAACCAATAAAGTCAAATGAAGTCAATTAGGGATTTATTAAAAGGACTA
ACTATACTAAATAGAGTTCTACTTTACCTTCACTGAGTACTCTTACTCCGTATCGCAATCTTCCTCTGCACATACGTGTACGTGAGGTAGTCGGACGCAC
ACACCCTTGCACTGTCAGCAGTGCAAGGTTTATTCCGTTAGTTGAATAAGGTGTGCCCAGTTACACCTGGTAGCACTTCGTAGTCCGTTCAACGACCATG
AATATGTTGGACGATGAGGGGGATGATTTTCATCCCACGCACGAAAGCTACTCCCATTTGAGTCAAATCGAATGGGATGCCGTCGAACGCTTGAGTTAGA
CGATAGGGCAAGAAGCCTTGGCGCACTGCTGTCCGCCCTGGGGCAACGGCCAGCACGCCACAATCACCACGTTCATTCAGAACGAACTTGATGCCGAGCG
GGAAAAAGTAACCTTGCTTCACCAACAAGGTTCTCAACAGACAAAGCTGTTTAGAGAACATAGTGCTCAACAGTTTGAACTGTTGAGACAGCAGCAGGCC
ACTGCTACCGGGTCGACGTGTATACGTCGACCCGAGACTCTAATGATCGACATCACAAAGTACAAGGGAGCCGATGGAGACTCCCTGTTGAGATGATTCG
TGGAACTAGACGATGCCATCAGGGCTCGTCATATCGTCGATGAGGAAATGTAGATCGCATTTTCTCAATCGAACTTGGCAGGGCGTGCAAAGACGTGGGC
CTTGGGCCTTAAGTTACACGACCCATATTTCTTTTGGTCGCTGGAAGCCTTGAAGTCCCTGCTTAGGTAAACTATTGAGCCGCCGCGAGCGGAGTTCAGG
GCTCACTCTGAACTACTGAGAATTAAGCAAGATAAACGTGACGTACATTCAGTACATACGTCACCTTACCATTTGCATAACAGTCGACCCACTGAATCAA
CAAAAGTTGATTACGTTGTTCATGCAGGTTCTGACAGATGGTCCTGTTAAAACCTACCAGTTCCGGTTGGAATTCAACACCCTAGAAGAGGCGATAAGGG
TTGCGGAACAGGAGGACTTCAGCGTGATACAGGCTCACGCGAATTCGAATTCTTATCGTCCATCGAGAACACAGGAAAATGAAGGCCCAGAACCAATGGA
CCTCTGTCACGCGGGGAGCGAGAGCTCTCGTGTTAACAATTACAAGAAATTGCAAAAATGCAATAGATGTCAGAAGACAGGGCATTATGCATACGAATGC
AGTGCCCCGAGAGCGGTACCACGTACCGCAGGAAACAATAACCGCCAAGCGGCCAAGAGAGGTACAAGGCGTGGGTCCGTAGTTGTTGCGAAGACGCAAC
AACGAAACGGACAGCCAAGAAATGGTCAGGGTCAGTAGGTGCGGAGCACCCTACTGATCCAGCAACGTCGAGTGATTTTGCAGGCCTCTAGACGAAAGTT
TCTCCCAACACTCAATCATTGTGTGTTGCTGCTTCTGGTAATGAGGTTTCCCTCATTACCTTGAAACTCGAAGTGACACGAAATATGCCGCTTCAAGCCC
TAGTCGATTGTGGGACGTCGAACAACTTTGTACGACGCCAATCGCTGGACAACAGCGAGCTCAACTATATCGAGCGCGAGATCCCTCCACCGAGGATGAC
GGTGCGCCTTGCAACAGGCGCATCCGTGACAGTATTGAAACGTGTAGTGAGGATTTCCTATACACTGAAAGAATTCCAATACGATGATGACTTCACCGTC
TTGGACTTGGATGAAAAACTTGATTTTATCCTTGGTTTACCATGGATTAGAAGGTACGAGCCACAAGTCAGCTGGCATCGAAGAAGTGTCGATATGCCCG
CCGCTTGTTCACCAGACGCCCATTTGATGAACTTCTTGGAGCTTCCACCACTATGTGAATGTTCTACAAGTAGGTGCGATGTCATCACGTGTGGTTCGGT
AGTTAGTACGACTGCACAAGATCGCAATATGACTTACCATCACATCGCGGAGCAAGTTCCCGACGACTGCATAACAACGCACGAAACTCCGAAGGCCCAC
CTCTTGAATAAGTCGAGCGGACCAGGGCGTGGTTGTCTTCTTAGAGGGAAACACCCAGATCATGACCAACCAATTTCCAACCATTGTCAGTACGGAGATG
AAGTAGCCCAAGAGGCTAGAGTTGAGAGAATAAGTCCCCAATGAACAGTGGAAATAAGTTCCCAATGAGATAACAGAGACATTGGATGTTCTGGTTAACG
ACGGATCAAGCATAGGTAGTCATACACATGATCCGATCGCGCCTCCGAAGTTGACTTCGGAGTCACTCAGTTACCCCCCCCCTGAACCAAAAGAGGTTCA
TGCGTGATCTGCGTAGTGGCAAAGTCAAGCAGATTTGCGTACTCATCGCGGAGGATGAGTACGTTAGTGATATCCGATCGGCAATGGTGAAAGCGTTTTC
AGTAGCTCATCAATGGACGAGAGTGTCCTTGATGAGAAGACTCGGATTGAGCGATGTACATCCCAATCGTGGGAATCTCTCAAGACAAATCCTCTCTACG
ATGATTTGATGGAATTTAGGGACGTATTTTTCAGAAGCAATTCCGTGCGAGTTACCTAAGGACAAAGGTACTCGTCACGAAATCAACGAAAAACCGGGTT
CAAAGTACTGTGTCATGAAGCAATGGCCACTGCCCCGTGAACAAGTACGAGCGATCGACAAGTTCTTTGCCGATCGCTTGGCTGCGGGTCATGTGAGGGA
GTCCATCTCTGCACATAGCTCTCCGACCTCCTGTGTTCGAAAATCCACAGGAGGATGGCGGATAGTACATGCTTTCAACAAGTTGAATGCTGCAACTGTA
CCGGCTCAAACACCGATACCAAGAAAGGATGTCATTATAGATGTTATGGCAAGGAGTACCATCTTTTCATCGATGGATCTGATGGACGGGTTCTATCAGA
TCCTTATGCGTGAAAAGGACATTCCTTACACAGCAGTGAGCACCCCAAGCGGTATGCTTTGGGAGTGGTTGGTAATGCCACAAGGGCTGAGTAATGCCCC
TGCTACGTTCAATAGATGTGTTACGAATCTGTTGATATATGTGCAAGAATTCGCACCTAGCTATTTCGATGATGTGTTCTTTCATAGCCGGGCTATGGAT
GGACAGACGGAATTGGAAGTTCACCGACTCCACGACCGAAAGTTTCTTACACTGATGCTTGAGCATAAGTTGTACGCCAACCTCAAGTGGTGCATATTTG
CTGCAAGCGAAATACCACTTCTTGGATGCATCGTGGGTAACCATGGCGTCCGGTTCGATCCGGAAAAGATCAAGGTGATCACTGACTGGCCAGTGTCTAC
CGACATAAAAGGACTTCGAAATTTCCTTGGCCTAGCGGCGTATTTGCACAAATACTCGCACAATTACGCCGAGATGACTGTTCATCTCTCTCGTTTATTG
AAAAAGAACGAGAAGTGGGAATGGAGTGCCGATTACCAGCGCTCTTTCGAAGTTATCAAGCAAAGCTTGATACGATCGCCGGTTTTGGCAATTGCAGACC
ACGACAGGCCATTCCACGTGGTCTGTGATGCCAGCGACTTCGCAATCGGCTGTTCATTAATGCAGTACGATGCAGAAGATGCGGAACGTGTCGTCTGTTA
TCAGTCACGCCAGATGCAACCTGCTGAACGCAATTACACCGTCCATGACAAGGAAATCCTTTTCATTAAGTACGCGTTGGCTAAGCTCACAGTTTCTGCT
AGGTGATAGACCCTTCATCGTTTATACGGACCACGAGGCTGTAAACAGTCCACACCTCTCGCAGCGGATGGCGAGGTGGCTGTCATTCTTTGCGGGGTAC
AACTTTTCCGTCGAGTATAAGCCAGGACGACTTAACGTCGTCGCTAACGCACTCTCGCACGGGCCCGATTTCGAACCGGCTGCGACTCCAAACCCTGGTC
CGACCACTATCGCGGTACTGACTTCGAGTGTCCCGTAGTCAACCTTGTTGGAAGACATACGAAAGGCGTATGATCCGGGAATGGTGCGATTAATGGATCA
TCTCTCGCATTCATCCAAGAATAGTTTCAAACAGTTGTCGTCAGTATATCGGTCCTCTACGGATAGATATACAGTTCGCAACGGCTTACTCCAATATTCG
GCTGTTGCCGGCGACATACCTCGTGTCGTCGTACCAGATCATGGTGATCAGCGATTGCGTATCATGTATGACTACCACGACGCACCTGTTGGTGGACATC
GTGGTCGTGAGAAAACATATCTCACAGTGAGCCGCGACTTTTACTGGCCCCGCCAGTATCAGTTCATCCGCAAGTAAGTCTGCGCATGCGAAGTATGTCA
ACGAGTGAAGTCTGGTTCTTCACTTCGTGCGCCGTTGCAACCCTTGCCCATTCCGGCAGAATGCTGGGAATCCGTCTCAATGGACTTTGTTTTGGATTCC
CTGGAGACTCTCACAAGAATACTTGTATTCTTGTGTTCGTTGACAGGTTTAGCAAGATGGTACATCTGGTTGCTGTACCCTAATCAATCAACGCATCGGC
TTGTGCCCGTGTCTTTATCGACATAGTCATTCGCCTTCGTGGGTTGCCTCCTGAACTCGTGTCCGATTGGGACCCGCGGTTCACAGCTGAGTTCTGGCAT
TCCGTGTTCAAAACACTCGGAACGCGCTTAAGATGTCCCCGTCTGACCATCCTGGTCAGACAAAACGCACCAATCGTGTCCTCAAAGAGATCCTCCGAGG
GTACGTCCATTCCTATACGAATTGGACTGAATTCCTACAGATGGTGAATTTTGCCATCAACAATTTTGTCCATGCGTCGACGACGCACACGCCGTTCTTC
GTGAATAGCTTACGCCATCCGCTTCTTCCCACCTTTTTAAATTGTGACTCTATTTTAAGGGGGGAGGGACTCATTCGAGCGACCGCCAATCCGGCATTCA
CTCGTCACGTGCTGATAATGTGGTCACCACGTCCTACGACGATGTCGATCACATCGACGTTGGTGAAGAAGAGGAAATTAAGAGCGAAGATGCTCTTACT
GACCACAATACTGATCAAATCAGCACCAGGCCTAGTGCGTCCAAAGACACACTCACCGAGGCAACAAGTGATCTTGCTGCAGTACGCTCCAAGAGCACTG
CAGCTAAAGACAGCGAGTCAGCAGATGAATTCATACTGGCTCGCGAAACGATTGTCCGTTTCGTACAAGAATCTATCGCAGAGGCGGTAGATCGACAAAA
CCGAAACGCTTACAATAATCAAAGGGCAAATGTTCTTTTATTCAATAAAGGCGACTTAGTCCTACTATCTACGGTAAACTTACCTCGACACATAGTGACT
AGCGTGGGCTGTAACAAGTTACTACCCAAGTTCATCGGTCCATTTCGTGTGCTGCGCCTCCAGGGCAACGCATATACAATCGAATTTCCACGTAAGATGC
GCACGCATCCTACCTTTTGCGTCGGTCGCCTTAGGCCGTACTATCAGTACGGAGCTTCTTCCGGTGAAGGCAGCCCTTGCGCTCAAGCATCTCCAACAGA
CACTTGTGCTCACGATGTTGTCTCTCAGCCCGCGTCTGAAGTTCGAATATCTCCCCGCGAAGCCAAGAGATATCCTGACGAGATTCCGTCAGCTCGTCGC
GGAGAGAAAGCTCTTTCCGCTCATTCGTAAGCTGGGCAAAGGCATACTATGCCCTGTCCTTCCCGATCTGATCTCAGACGGTTCACATTGCCGAGCAAAT
ACAGACGCCTGCCTCTCTCTTGTTCGATGTCCTCGCGCAACTCACACGTTACGCGGTCGAGATGACTCACAGCATCAGATTGGCCCCACAAATCCATCGG
ACAATGTGTTTTCTCGTCCGACTCATCCATTGGTCGATACGCGCGGTGGTAAACGCTTCCCCATGGAACGACTGTTGAACCACCGTGATGTGAAAGGAGT
TTGGGCGAGCTATCCTCCCTCGGCGGATAGTTGGAAGCCTCGCTTGCAACTGATGGTGGACGTGTTGGGACTTGTCGAGCAGTATGACAAGGCACATCCG
ATGCCGAAGAAGGCCCGTCGGAGAACGAACGCCCAGCGCGTTTGTAGAGCGATTGAAAATTAGCTATTCTCTCGTACATCTCCGACGATACACGAGCCCT
ACACCAGGGGTCTGTCATTGAATGAGCTTTTGTCGGAGCTCGTGTCAAGTTGTTCACACAACATTGGCACCCATCACCCCAGGAGAGACATGGTAACTCG
GACTATCTTGATAAGTGATGCAGTTTGTAACGTGCACCGGTAGTAGTCCGCTTCTCTAATCGATTGCGAGACAGGGTCAACTTGTCAACCCAGGCTTCGC
GTCCAATTTCTCCAACGTTATGGATGAATGCGGTTCACGCCTGGATCAGCGAGGCACCATCACGCTTATGGTTCCCTCTGTACCATCGATCTTGAAGAAT
ACATCGATGTAGAAATTATGCTCAGTGCGAAAGTCACTCGCACTAGAGTCAAGGCCATGAAGCCTTGATGAATCGAAAATCCTAATTCGATAACGATTGC
TTACCGTGTCGGATTAGCGATCCAAAACTCTCTGAGGATGCAGCCACGCCTTCTTCTCTGGAGCAACGCGCAGAACGTCGCGATCTCTGGCTTCTTGCGT
GGTGTCAATAGAAGTACCGACACCACATCTATCACGGTCGTCTTGATTGTAACGCCTTACTCGTCACCCGTCATCGTAGTTCGACTGGCTCTTGCCACCG
CCCTAATTTCTCTCAAGCGAACGACTCCGCCTTGGAGACGGAGCGTCCGACTCGTCGCTCAGCGAGGCTCATGGCTCTTCGCAAGACCGACTTGTTCGGC
TGTGTCGTCGCCGCTTTCGGCTCTGTCTTCGCAGCAGCCTCCGTCGAGTCGGTGTCACCATCTGAATCGCCAGATTATATAAGCTCGAGGTCGTAATCTT
TGAGGCCACGCGGTGCATCACCGGGTGAGCCTACAACAGAAGAAGCAGCAGGCAAACTGTCGCCTGCTGCATTCAAGGCCTTTGCCTCATACTCTGCAGC
GGATCGTTATCTCATAGCTGCGTTTCCAGCAGCTTTGGCTGCACACCGCATGGACTTGTTAACCATGCGGGAGAACGAAGGAATGGTTGAAATTGACCAA
CAAGTGCTTTTCTTCCTCAGAGTCACTCATTGGATTCACTCATTCATCAAACAGTCACTAATGTGACTGATGGTCAAGGGGAGTGATGTAACGGGTTACA
TCCGTTACATAGTAGTTTACACAAGGTAAATATCAAGTATGAATATTCTGTTAGGACAAACAGAAAAAAATCGCACAATATTGGCTTAATAAGCAACATT
GTGTTGCAGAAGTAATACACTGCTCATTGGTTGATATAGATTAATGGTATCAGCCAATAAAGCCGAGCCACGACAGAAGAACGCAATGAGTGGTGAGCAG
ATAGTTACAATACATGTTTGTATTTAGATATAGTTAAAAGAAGACTAAATAGGATTTATTAATAGGAGATTAACTATACTGAATACAGTTCTACTTTTAC
CCCTTATCTCGTGCTAAAACCTTCCTCTGCACGACGCGTGTACGTGACTTCACGAGGCACCACCTTACTCTGTGCTCAGTTTAAGTAGCTTGTACTGTGA
CAGTACAAGCGACCGGTGCCCCGTTACACACTTTGCAAACAGTCTTAATAGCTTCACCTTCGGGCTCGCAATGAGCATAAGGGAAAGAGTAGACTCCGCG
CTGAAACATTCATCAAACTACATAATGCCATCGTGTATTTTCGTATATTAGACGGTGCAAGAGGATATACCACATCCATTTTGAATCTGGAAGGGTTTTC
AAAGCTTATGTACTTGACAGCATGCCTAAATGATTTTCCATTTAGTGTCTTCAAGACTCAAGCATGAGTTAGGCCTCCGTGTGCTGAAATCAGAGCTCAT
GTCTAGCTTTCGAATCTTTGAAGCTGGGTGAGCGTGATCTTCATGCTTGAGCTTAGCACACATTTTACAAATTCGTATATAGTTTTGACATTTAATGTTA
TAAAAACTGATCCGATATGTTGCACACACCAAGGTCTTATGAGGAAACGTAGTGGAGCCCTCGATTAGGAAAGGCCTGACAAGGGTGAATAATAACCGTC
CTTGATATGTGTAATGCGAGCTGCCATCTACCAATTGCACTCAAAACAAGATTTTATGAGTTCAGGTGCTACATAATGCCTTATGAACGGGTTGTTGCAA
TCGAATTAGTCTTTGCTAATCTATTATTTTGAGGCGAGAGTGGATCATCTACTTCACATATATTTATGGTCTCCTATTCGTGCACGGCCATGAATTATGA
GGTATCGCATTTAATAAGTCACATGCAGCCACGGTGACAGCATCGATGCCGAAAGAGGAAATAAGTATCGATAGTATGTCAACAATTATGATACACACTC
GATAATTTGGATGAATAATATTCGATCAGATCTATTCGGTATACAGTATAGATCGTACACTCCAGTTATCATCCACAAAGTATTTCTGGAAGTGGTTGCG
AATTCTTTAAGAAAATAAAATTGCACCAGCCCTATCAGATTGACGAGTAGCACACCTACTAATTTCGTGCTAAATTTTATAGAGTAAATCGAAAAATTAG
CACGAACATGAGACGACATTGCAAAATTTGCAAAATCAGCACCACTTCAGGAAAGAATTAATGTGTTCAGCGCTAAACCCACCAAATCTATATTCTTTCG
TTCCTCAATATTCGCAGTTGCGCACTCAATACCTCTCCATCTCATGGACACCCACATTCGGCGGAAACCCTCCCTCGTTAGACCCGTGAGGGTGTGTCTT
GGGCAGGCCTCTCATGCGGTCGCGGAATATGCGGAAGGGAGGTAGGAAAGGAGTCGAAGCTCACAAAATGATGGTGAGCCGTCAAACTGTTGTATTAGCT
AGATTATATAATTTTAAACTGTAGCATGTGACTGTGCAGCATTTGTGAAGTAGTCTTCAAAATCATGCAATATTCTATTCAAACAAATAGAAGCCAAAGT
ACCACAACTATGAGAACTACTGATGCGCTAAGTTACAGTTACAGTTATTGCCTTGTAATATTGATGTGTTTGAAAAAGGATGTTTAGAGTATCGTGTATA
TACATAGGTCGACGAGTTACCTTTGTATCATAGGTGACGATAGTACTGCTGGTCGCGTGTATTCACCATTCTGAGCAGCCTAGACCGGTGCGCAGTTAGG
TTGGATGTGATACAATTCGTATAAATGCGGCCACACACCGGATACGACGACTGTGCACTTAAGAGTAGTAAGCCTCTCATGTGGACTAGTAGCACCAATC
TAGGGGTACAAATGCAGATCTATTTTACAGCAGCATAGCATGACATTTCGATAGAGAGGCCGACATGATTGGTATTGTACAATCACCGGCCATGCTTGAG
CATCGCCTTTTTCATTTAGTCTTCGGCAACAGCATACATACAGCAGCGTATAGCTGTTAAATATAATCTAACTCCTCTCTTCAATGTTTTTACTATCATT
TGATTGATACGATATCGCAAAGAGCTACAAAATGCAGCTTTAGTCTAGTAACATGAAAATAGATCTTCATTTGTGGGTTTAGTTCAGAAGATTGTCGGGA
ACTGTGGTCAAAGTAGAGACAGATAGCAACGACATCAATGGAACATACAAATCACCAAGGTAAAATTTAGTTGGAGCGAACATTTCATTTTCATGGACAG
CAGAGTACGCACGGCGGCGACCCGTTGTCTGATCGTGCCCCATTTGCGTACAGGAGCATTATTTGTAAGTAACTCCGTGTTTTGTATCCCCTGAACTATC
GATCCTTTTCTTTTGCAGGCATCTAGACTACTTTTAGTACGCTGATGTGTCGATAAAAACAAAAGGGTTTCTTGTGCTGACAACCACTTTTATTTCCGTC
CCCGTGTAGCTCTTCTTAAGTCTTCACAAGGTACGACGTATTTAAAGCGTACGTCAAATCAGTTGTAGACTTCACAGCATGAAGCCAGCGACAGGTTGGC
GGCACGGCAATCCTATTTAAGTGAAGATTTAACATGAGCGTTTTAGTGCTTCTACTTTGACGCGCCGATATTTGGAACTTGTCTTGTGGCGAACCATACA
CCAGGCGACGATTGAGCCGCTTCATAATTTCCTGCGTCAATTTGCTCGATAAAAATGCTCTCGTGCATGCAGAGTAAAAGTGAGCTCCTATACTGTCAAT
TTCTTGTTCTGATCTTGACGCATACTGAACTTGTCCATAGTGGCCTTAGTCAAAATTCCGATTGCCTCAAGAGAAGCTTCATCACGAACACCTTATACTA
GTCAGTTGTCGCTCTCCACAAAGTTATACGTGCACCACCCAGACAGAGGACATGATTTCATTGGAGGTAAAAATTATATTGCTGTGAGTTGTTTTGATCT
AACTTGTGCGTGGGATCGTATTTGTACTTGAGCTTGTACCTACCTACATCACTGGCTTTCCGCTGCATATTGGTATGCAATGTCCACTAAATTATAGTTG
ATCTCTTTTATGTATTCGGCGACATCATGTTTAATTTGTCGCCGAATACATAAAAGTAGTCTGCAGCACCAGGTTTTAGCTTAGCGATGTAGTCGATGTC
AATTTCTGCGCACTGAAATTTCTACACTCTCGATATCTGTTCCGAAAAATCCAAATATAGCTTGATGCTGCGCCTTATTTGCATCGAACAAAACCAACTT
TGGACATTTATTCCTGTTTTTATCCACATTGACTTTGTACCACTTTAAATGGGCTTACTATGGACTCCATACGACTGCAATGTAGCAAGTTCGACGTCGG
CTTGAATACATTAAAAAAACACGATAAGCTGTCCTTGTTTTCTACGAGTACGAACGCTGTGGCAAGCGTGGCGTTTGATTATTTCCATCTCATCCTACAA
GAAAAAGTATCATGCCATTGTACTTGCCATGGCACGAATGCGTACCATTTAAGCCTATCACTGATGTACTAGATATGATGGCTACTGATGGACGAGCCAG
AGGATACGAACACTCGGAATAAGCGGTTGTCTTGATGTTTCAAGTGCATCAGTTTGAAGCGCCTTAAATCAACCAAGTGCGGGGTTTTGAGCGATAAACA
TGATTTACAATGCACATTCTTCTTATCGACCACTGCTTCCTTAGCTCTATATAAATCTTCACGCTGAAGATTGGTGCCGTCTCGTGGTGGACGAGCACCC
ATAGGATTATGCTTGACGTCCTTGTTCTCCCAGAAAACTTCCTTCAAAAAAATCGGAAGCAGCCGAACTAGATAGTTTATTGATGACCATGTACATATTG
GCGTGGATACTCTTGTGTTTTGAAACTTAGTGCTCCGTAAATGAATCTATTCGCTGTCGCTTCGTCACGCGAACCCACCCTTCATGAACATCGATCTTGT
GGGCATGCATTTGTCTTGCTATTTTTGGCACCCTTCTTTCACCCTTGCACTGTCAATTCTGGTTAAACCAAAGTCGTTTAATAATTTCGTTGCAGCAATC
TCGATCTAAATTATCTGCCTCAACACCAGCCACTTCAGTGGCACCATAAACTCATCTGATGCGATAGCTCCCTTAATCTGGACGTCCTAGTGCAATAATA
GATTTTCTCTAATGTTAACTTTACTTTTGGCACCTGGAGCCTCAGATGAACGAGACACAGGACCATAAAAAGTGTGTGCCCCAAAAAAGTAGGTATCGCT
AATGCTGATTTTGCGACTAACGCTGGTTTTGCAATATTTTTCTCAGGATGCTGCGGATTTTGAAATTTATCCAATCTTTCGCTCCCTGTTTGACGAGTGC
TTGCCCAATTTCTCGAATTGCATCGACAGAGAACGTAAAATTTCATAAAAATTGTGTCTTGATAGTTAGAAAATTTTACGCCAGAAACAAAACGTATGGG
AACTCTGTAGTGTTTTGGTAGAGTGGCTTTGAGGTATTTTCGCAGGGTGCTTTAAATTATCAAAATTTATGTTTTCATAGAGACCATTCGTTTTGAATTA
TCCATACCCCCAAAACATTTATTGCGTCACAATTACTTTTACTTTCTTCGCCACCTGTACTCAATGTGTAGAATACTAGAAACTTTTCCTGAAACGAGCA
GAGGAATGGCAACAAAAAGTTCTAATATCCATTGTCTTCTGTATTCTTTTTATATACTATTCTAAGTGCATCGTGCGAGACGTTCTATATGCGCTCGATT
GAAAAAAGGTGCTCATATTCTAGCAGTTGCGGGTATTTTTATGAGCTTGGGATGTTGTGAGGACTTGTAAGGGCGCTGTCTACATATACTCGATATTGAG
CGAGATGATTGTATATCTTTGATGTTTGATTAATATAATGTGAAGCGGTCTTGGAGCTACAAATGGCTGCGTTCCGTAGAAGATGCTACGCAAACTTTGA
TACGATTGACGGTGTTGGTGGTCGCAGACTAGGCCAAACCTTTTCACGTGGTCCGTGGCGTTAGCATTTTCACAATCTACTGCGCGGAATACGTCGTAAA
GGTATGAGTTGTGTAATCTGCAATCAGATAAAGGGATTACCCTGTGCATGACAAGAAATTTCTTTTTTAGAAGTACGCGTCGGAAACAATCGAGTCGATA
TTATAATAAGTGAACTCGTCATGATTTATACGGACTACTCGATATTATGCACGACCGTAAACATTTGGAGCTTGTTGAAGTTAGGTATTGACCAGTGGGA
TGATATGGAATTGACTTATCTACCTAGTACCGTCCCACACCATATGAAATTCTTGCGGGTGCGACAGAGCTATATTGTTTAATATAAATGTTGTCATTGA
CCGGATGTACATACATTAAGCGCCTTTATAAAAAAATTGCGCGGGGCTGAATCACCCACAACATTCAATCACTATCATCACACCCTTGACATAATTATAC
AGGTGAGCATAAGCCGTATATGCAATCGTCAGGGTAGATTGAATATATTGCCCATATCACCAAATAATTAGGTCATTATCCTCTCTTGATTGTTTCTCCT
ACTAATTTAGCGATATTGTCGCCGTGAATGTTTTAATCAAGGCTATTTCAAAATGGGAACCGTTATTCTCCCCTCAGTTTTCTGGTAGAATCCCCTCACT
TTGATATAACGCTATATGATTGGCTAGTTATGAGTCGAGAACATAGGGAGCGATATCAGTATCAGTTTGGATTTTTGAAGTCAGTTTTGGTCGTAATCAT
ATACAATTGAACCTTTTAGGCGCAAAAAATGTTGTGTGGCAGACGTCATTGTCAGCGTTCCAGCCAAAGTAAGCGATGTCCTTAAGTCAAAAGACGTGAG
TGAGTAAGTGAGTGAGTGAGTGTAAAGCCATCATATAGAATTAAAGAAAGCAACGATCAGCATCACTGATGCAATAAACTTGTTAGAGTTTGCGAAGAAG
ATGCGGCCGTTGCATGAGGGTGGGTCACCATGCACAACGATGTGGAAGTTTAATCGAACTAACACCTACTAAACTTAACGGAACCGATTTATATATCAAA
AAAAACTTTGACTGCATTCCTCAGTACGAGTCTATATACTTCGTAGGCAATAACACTCGTGCGTTACTGAAATAGACCCTAACTTACACGAGCATGCCGT
TTCCTCGGCTTTATTGGCAGCATTAGCAACTGAATTGTCTTTAAGCAGTATCTCATTTGTTGCAATGCCTTAACATCTTCGTAATAACAGGGGCATCTTT
TTTTAGCTACGCATGCGCGATTGTCTAAAGATCCCTGTGGCTACCATCTTAATGTCCTCCTGCATGCTCTTATGCGGACCTACATTGCATACCAACAGAT
TCGGAACAGCACAGGAAAATAGAAATCTACACAGTTAAAAATAGGATAAATAATTACAACACGCGTCGTGTTCATGTGACACAAACAATCCGAATACGCT
CCAAAATGAATACCAAAATAAGAAGCAGTCTTACCACTCACTAGCACAGAAACATTTGTATGTAATCTTGATGGGGATTTCTTGCTGTTCTAGAGGCGAC
GATCTTTAAATATAATGAGCGATTGAGAGCATCTGCGGACGTAAAAGCTCCGAGTCCGCAAACGTTATAGGCAAGGCTTGACAGAATCTTGCGCTAAAGA
GCACTTAAGAACAATTGCGTACTATTTTGAATTAGGTCAAATAGATGATTAGAAACCGGTTATAGTGATATAATACCCCAAAGTCATGTCTACAAATTAG
CCAATCATGTAGCGTTTTATCAAACTGAGGGGAATTTACCAGAAAACTGAAGGGAGATTAACGATTCCCTTTAATATTTAATAAATATATTTTTGGGAGT
AGCAACATTCTGTCTTTAAGGAATTCATCTTGTCTAGTACTGTGTCGATAAATGTGGACGTCGAAACCAAAGTCCGTACCAAATATAATAGCGAACTCAC
GGTTGTAGCCAATCGACCGCGAAAGATCCGAAAGAGGAGACAGGACTTAGACATTAACATAAACCTACTGACAAGTATACTTGGAAGTGAACTACTCGAG
CTTGCAATAATTGAGCTGACTGGATGGAGCAGAAAAGATTCATCTTGCGTTGATAAGAGGTTTTAACGCATCAAGTCGGAATTTTTTGCGCTGAAAATGC
TGTCACAATGTATGTATCGTTGCTAGCGTAAACCATCCGTGCAGCCATTATACAGAAGAAAGATTGGCATATAATGTAGAAAGGTAATGACAAGTTTTTA
ATGTTTACTGCTCTAAAAGGAGTTCAAGAATATGGGAGCGGCCAATGAGCCTTCACGTTTCGCTAATGGGCCTTCACCCTATACATTAAACATGCGATTT
CATTTAAATGCCTCATGGGTAACTCTAGTCGTTACGCATTTATTAGATTACGACGGCTGTTGACAGTAGAGGATATTGACCAGCATAGTTGGCTGGTACG
ACCTTCACCAGGATTGACACCAATTTGTTAAGATATGATTCTTTCCATTGCAATAATGTTTTTGGAAGACTTCGTGAGAGGTATGCTAATACTGATGGTA
TCAGCAAAGGATCCTATAAGATCATGCAGCGCCGCTCCAGATGCTGCAATCCATTATCCTGTGCTGTTAAGGACGCGCGGGCCCCCAACAGGCTATACCC
ACCGCATTTAGTCTCTATTAAAGCATGTGGTAGCTGGATTTAATCCTACGCGACGTCGACAATGTGGACAACAAGGTCACAGCTTAATGACCTACCTTCA
AGTAGCAGAAGTTCAGCACCTTTAGCAATGCGATGTATCGATAATATCACGCCATTCGATTCTGTACGTGATGCTGTCAACACTGCTCTAAACTTTTACC
TGTTGATGTATATGGAGATAAACGTTGATGATGTACATATTACTTTTACTTACATGCTAACGCTACGTACTAAACTACCATCAACCACACATTAAGTTCT
GGCTGAATGGCACTTCTACAACCTCTCAAATCTGTCCACAACAGGCGGTTCAAGAAATGGGTGTGTTATAGAGCTTAATCACAACTAGACGTCGTGAAGT
ACAAAATAGGACCTTTGACCGACCATTTTTTAGGCCTTCAAATCCGATAACTGTTTAGTGTATGGGGTGAAAGCTCATGAGCGAAAACTGAAAGACCATT
AGCCGTTCTAAAGAAAACTTAAAACCTCAGAAGATTTTAATAGGTGCTCCTAAGGGTTCAGTTTAACAGTAATAAAATATTACCCCGGCGTAGGTGTCAG
CTGGCATACGAGGTAGAACGCACTCTAGACTATAATTTGATCTTTATTAAGTAGCTACGCATTGCAGCATGTTATTGGTAGTATCGTAAGGCTTACCAAA
CGCATTTATTAATCAAAAGAGCTTTGACGATGATTATAATAGCCAAATCTATCAGCAAGGGATGTGTTTTAAATACACAAGACGGTCCATGAAAGCGCAT
AGCTCAATTCCGAATATCAACACATGGAATGTTTTCTAAACAAATCTCACCATCACCTGAATCACTATTGTGGGGCCCCAGTAATAAGAACGTCTATCGG
ATTGTCGCGGAGGGCAATAGTGTTATTGTCGAAATTATCTTCCAACTCATTAATGCCTAATTTGCCGCAAAGTTAATTACGCGCGCCAAGCGACCGAGTA
AGTCTTACAAGTATAAAAACATCTCAGCTGGGGGGGTACGGAAATGTGGTTGCCGAGCACCTCGCTTTTCGGAGAGTAAATCCAGAAAATAATAGGAAGA
GTAGTCCTCATAGTTCGAAGAATATGCCTATCCATGCTGATACTGCTGTGGTTGGCCACGATTACTTTGGCCAAGAACACAATGTCATTCAGATTCTGGT
CTTCGATATTAAACCAGATATTTTTGAGCCGGGGATCGGCTTATAATTAGGTGGCGTTTATACGTCGCAAGTAAAGTTGACTTTGAAATCGATCTACAGG
AAGTAATAATTAATCTTGCCCATGGCTGGAAAGAGTTAGTGTCTTGAGTATCAATACGTCATATGAATATGGGTTTCTCTCAAGAACAGCATTGAGGGTG
GCCACCCCATTAGCATCCGTAGCGGCGTGCATGCTCTATACTCGGGATTGCACAGTACAAGCACTTACAACCTATGGATACTTTTCCGTTTGGTACGGCA
AAGCACGACGAACAACCAGATTCGAAGCGGATTTTTGGCACATAACGAGTAGAAGTAATATATATTAAGATTGAGGGATAGATGTCATTATTCGTTCGAG
GTGCTCTCAGTTTTCTGGTCGTTGTAACGGGCACTAGTGACTTGTACTGACACAGTACAAGTTCACTTACACCGAATCTGTGTAAGCAGTGCCACTTTCC
GTACATGATACTTGCAGAGAAAGACTAACTATCAAACACTTGTCTTATAGAGATAGAAAGTAAAACTGTGTTGAATATCATTAAGTCCCAATCATTTACC
TGTGTCTAGTCCTAACATAATTATATCTATCTACATAAATTTACATTGAAGTCTTGCTCACAACTTATTGCGCGCGTCTATCACCGATTGGACCGCTAGA
GTTGGCTGATACGATGCTACATATCAGCAAATAGATTACAGTAGTGATTTTGAATGTTACCCTTCATGATAATATTCATGAACATTATCAACTTTTATGA
TAATTATATAATTAAGTAGTATAAGATGATAATTATATGTAACAGGCTCATTCCGTTACAGTCGTCGATATATTCCGCGAGAATAGTGAGATTCTCGCCC
TCGAAGGTTGCACTGGTAGAATTGAGCCGTGGGGCATTAATCATGTGGAGAGAAAATCCTCTCAATCTATAAGTCTTGTTGCGCTTGGACAGGGTTTGGA
GTGATCGATCACCCGGTTCGACCACCTGCCAGGTATACCTTACCTAATCAGGAATTAGCTTGCGGTACTGCTAGACCTAGCTTTCGCTCGATAGCGCTGT
CAGGTAAGAGTGACGATCCAGTTTCAGAAGTGTTTTCAATGTTTACAGGGTGGATGCTTAGCGATGATGTGTAATCACAGATAAAGTTTATGATTTTCGT
CGATGGAAAGACGTATTTCTTATTTGTGCTGTGATGGAGGCTATGTAGAAACAATCGTTATAAATTGCATCAAAGTTGTAGTCTGTTATTATTTAAAGTA
ATATAAATAAAATACCCTTGAATCTATCTCAGATAATTCTTTCGATAGTAATTTGTTTACTTAACGATTTAATTTCTGGCCCCACTTTTGAGAATAACAA
AAGACATCTATCATAATCCAGTTCAGTTTAGCATTCAATAACGATTCTCAGATCCAGCACAAGACGACCAAAACGATTATTTATGTGTATTTTAGAGCTG
CCAATCCTCATACTCTTACATACTGGTATTTCTATCCCCATGTCATCTATATACGAAGTTTAGGAAATGTGGCATGTTGATATTAACATGCCTACTATAC
GATAACTATTGTGAGTCGATTTTGTGACAGAAACATCGTCGTAAAACAAGATAATAATGATATTAAGTTACAGACCATGCCAAGGATGTGCCATATTTAA
AGTGACAAATTTGTTCTTAATATTGCAGGAGCTATTTTTTAAAGCTTAACTGGAATGAGATGAGGTCGTTTCTCGATACTTTGGAGGACAATGACTGAGA
ATTCATTGGGGACGAGATATTATAAATAGGTAGTTTACCCAAATAAGGGCCATGTCTCGTGCTGCAGCAGACACTACACTGAAGATTCAAGTGCAGATCG
AGAATGCTGCTGACCACCATCCTGGACGAGAGTACTACTAAGGAATCTCTGTCAGTGAAGGTCTTGATCGGCTCTCCTCCTTGTGAAAAAAAGATTCTAC
TGCGACGTTACGACTGCGATGAGATGGGCTATCCTTTTTACATTGAATTAACTTATCTTATGCGGGCAAATTTTATTAAGGCTCTTATAATCTTTCTGAC
CTTATTAAGCATCCGCATTCTGGTGAAGACACCATTATCCCCGAGGGGTTTAAGCGTACAAATCGTGCCGAATAAAAAATGAAAGCAGATATGGACGCCG
AATGTATGAACGACGCTATAGTAAATGAAAGTGACAGAGCAAGTGCAACCTATGACGACGACACAAACAGAAGCGGCAAAGGAGACAGTTATAATCTGTA
CTGAACGGAAGCAAGGGATCCAAATGAATGCTGATAAAATAAACAGGTGGTTAGAAGGAAGAAATCAAGAAAACGATGAATGTAAAGCGGTAACAGCGTC
TTGATAATTTGGTGGTGAGTTGATATAAACATTTAAGATGAATTCTACTATACCTCTGTTTCCTTTTTTCCATTGACCTATCAAATGGGGCGTCTTGCCG
CTTCTTTAATGCAAATTATAAGAAATTTGACCGGGAAGGCTAGTTCTTTTTCTACGAAAGTTGTATATTTTTCTGCCACTTTGCCTCTGTCGCATAAGCT
GAGCCATCAATCGAAGTAAGCGTTTAAAGGAGTTTATCATGACAAGATCAATTCAATTGTCACTTTATATAGGTTTCACGTGCTACAAGAAGTATTTTTT
GGATGGTTCACACTTAGGAGGGGCTTACAAAGCTCAAACACAGCCCTTCTCGAAAAAAAATCAATTTGGGAGACAAAATATGATGGCAACTAAATCGAGA
GCAAGATAGCTGGACTCTGTAGAGCTGCATCAAGAATCTTGTAGAATTGGATATTTTGTTTTCCACAATAACAATAAATGATGCAGCAGCTCGCTGCAGA
AGAACGCAAGAGAAAGATTTCCGGCAAACAGAGGAATGAAGGAGCGAGAAATTATACGAGACGATCGTAATTTTCATCATTCAACATTGTTTTAGCTAAT
TTTGATTTGTTATTTAGCTTCAGCTCCATTCGACCATTTACAGCACTAAACCTACAATAATTTACAACGGCATGCATTTACTCTGCCATTCCTAAAACAA
TAAATCAAAAACAGAGATCATGATATACATTCAAAGCATACAAATCGAGATTAAATTATTTTCCATGATTTCGTGTAATCATGTTTTCAGCATTTTCCGC
CAAAAATAAAAATATAGTGAGGATGTTACTAGCGTTGGTGCACCCAACTCGATGATCTAAAAATCGGTAGATTTGGAGTGTACTATAACCTCAAACTTAC
AGGTTTAAAGCGGACCGAGAATCAACCGTAGAAATACCTTTTAAACGCTCTTATACCTCATTCATCTGCTTGGATAATGAATTCTACGGCATTTTTTCAA
GCGGTAATTTTACGCTTATCTCCCCTTCTTGCAACATCTCGTCTTAAAATATCTATTCTGAACGGAGCAACAACTATTTGATATCCAAAGACGGAAAGGT
GAGTCTGCGGCGAAACCCTTGTTATGAAAGTTAATTTTGGGGTCGCGAATCTTTCCTAGGAGATATCAAATTGTATTGAATCATTTTACAATATTCTAAG
CTATTCTGCTTTATAATGATTATGCATCCATCAGCACAACCTTCCTCGGTGCCTATCAAAAGAACTACGCCTAACCACAGTTTTTCATATCTGTCTACAG
TTCTTGGTTTCTGGACAAAGCTACAAGGTAGTTTGTGCCGTCGAAAACCCCGAAATTTCGTAGTATAGGTTTGTCCCGTGCTTTGATACGAAATAGAGCG
AGTCTTAGATTTACAGCATATCATCGCATCCAGTATATCATCGATTTCGTGCTTAGCAATAGCTCTGGGTTTCAAATGACGCATTGAGAGAGAGACGGTG
GGACTCCAGCTTTCTCACTGGGGTTCTTGATCATAGGGCTTGCATATTTTTGAAGGATAAGAGCAAGGATGAAACTTTTGTACATAAGGCGTGCGGGTCT
TCGTGGCTTCCTTGTTCCGAGAAGACAACGCGGTAAGTAATAAGACTCTCCAAAGATCATTAAGGGTGGCACGAAGGAGTTGGTATCAACCATCAACTTG
CTTCTCCCTTCTCAAGTATATAGTGCACCGCGACCGGGCGGAATATTAATAAGCGCCTACTTTTTCCAAGTAGAAGCGCTCACGAAGTTTCCCATATATC
TAAAGAATAAGAATAGGAAAGGAACACGAATGAAGCTTTGACTGGCGGTTGGCTTTTGCCTTCTGTATTGGCTCTCCTTCCGCATCATTTAAAGAAAGTG
TCGAGTCTGGATATCGAGGGTCATGGATGGTGTTAAAAGTATGAGTACTAGTAAATGTTTTAATCTCCTTATAGTTGCTCTCTTATAAGCTTGTACCGTG
TTATTGCTTATTGAAATGACGCCGAACGTGTAAATTTTACGCACAATATATATTATTTACTTGGCTGCTCATGTCTTCGTCAAGGCGACTTGCTTTATTC
ATGTCAATAACATACTGAGTAGCTCTGTTTATATTGTGGTTGTAGCTATATTACCAACCACCACTCTATTTCCACTTCTTGTCCCATATTTGCAGTTTCG
ATACCTGTTCGCTACCGTGTCCGTCTTTTAGAATATATACTGGCCTGTGTATAGTTATTTCTTGACGGCCTTTGCAAATCCAACTGAAGATAGCATAAGT
CCAACTGTTTATAGCATATTAATAGAGTAGAAGATTTGTTAACAGACTAAAATCATAACAATTGTCGCTAAAGCTATACTGGATAAAATCACATATTAAA
TGTCAAATGGCGTTTGCGAAGGCTTCAAAGACGGTACCTGTGGGTTTATCCAATGTGGGGTTTAGGTTGCTAATTAAAACTATCTTGATACACATCCCTA
ATGATCTGCAGGATGTGCGAATTGTGTGGGATAGCATAACGTTCAGTATACCTATCATCACCATTGCACTCATTTTTTCAAAAAACGTGTACAACCCGGT
CGATATACTATAGGGCAAAGTTCTTGATTGCGTGCTCTGTGTCCAATGTCCGAATTGTTTAGCCTGCATTTGATTTATATGCTGTGCAAAGAATGCTCTC
AGCGTAAAGGAAATCAATTTTCATGACACGTCCATCGATGCAGCACACAATAGTGCCATTTATTCATAAACTTGGTCCCTGCCATATTTTTAAGGTTCCA
AAACTGATTCATTTTTGTTTAACTTGTTCCATAACAATCTCTGCTTGACTGCTGGCTTTCACGTGATGTTCCCACATCGATAGTATACGTAACTAAATAC
GATAAACTTATCGCGTTGGGATATGATAATTACAATGAAGCTTGATTATTGTAAGTTATAAAGATACGGGGCACAAAAACTAAAACACATATCCATTAGT
CGCAACTAGTCCCGGGCACCGTTTTGGTAACATCGACATCATATCTCTCACTTATACTTTTGCCTGTTAATAAATGCGCGAGGTTCGATGGTCTAGACGC
AAACCCGCAACGGCTGTGACACGTGGAGCAGTCTTAGCTTTGTTGGCATCATGTGCTCATGTTAAAAGTCCTATATCCTCATCAACACTCACAAGAAACA
GAGGCAACGCCTTGTATTATGTATACTAGCAGTTATAGCTGATCTATTCACTATCCAGCCGTAAAAGCATTGACTGGTCTGGTAGAGATCGAACATACAG
AATGAGCGCGGCTATTAGTTGGACTATGTTCAGCAACTTGTGGTAATTACCTATAGCTAACAAACGTAATAGCAAATCACAGACTATGGCACGCCCGATT
AGTCCGTTTACACCCCCACACCTCTTTAAATTCTTCACACTGTACTTGCCCATGTTGGGTGGTCACTAATATTAATTAGAGCAAAAGGATCTTCTTATTC
GATATCAAAAGCAGAAACTATGTAAAATAAAGGAACACATAACGTTCTAAGCCTGTTAGCAATATTTCGACTCATTACATATAATATATTAGTCACTCCG
ATTCGGGAAAAATGTTAGGAATAATAAATAAAAACATGAAAAGTCACCAATACATTCAAATAAACGTGACCAGTATATCATTAGCTACTTTATCGAATAT
CATGACCTAATTTGTCCTGAAAGGTCGTCAAAGTCAAGTTAAGAGCGACGGCGCTTTCTACGACGGTGGTGTTTCTATATAAGACGCCTGTGACGCTCTT
TTTACGTCCTGATACTTATCAGCCCATAATAAGAACGGATTATACCATCAATCTGAGTGTAGCACAACGGATTGGTTTCCACGTGGAATTTAGACCCACG
CATGCCTGATAATATCATCATACAAAATATGCCTTCGCCTATGATCGTCGGCACAAAACCGCCACAGCGCACGCAGCATGCCGGAATAGTTATCCATACT
GAACCGTTCCCTTGGTGTTATAATTATCGCACTCTCCATCCTCTAAAAGACGGTTTTAAGATTTTGCCCTTGCTCTATAAGTATCCGATAGCATTTGCAC
ACTTCCTTGATTCCTCTACTCCTACATGTGTGCCCACTCATTCGAGAACTGCACATTTATAGGGTCGTGGTCTTCGGAAGAAAAGTCTCGTTTTGTATCG
ACACACATCTCATGATAAAATCAACACTGCGCCTGAAAACTTGGATGTCCGAGACGGTCCCTTTAACAAAGGTAGTACAATTTATAACAGAGCCACGAGG
GTTCTCCGACACTTCTACCCTTAGCCCATGTAGAATGGTGCTTGTCGCTATAAAAACGATTCTTCTAGCCGCTGTTGCCTGCGGGTTGGTCCACTGCTGA
AAGGTGACTTCCGTAGGGTAAATAGCGCATAGGAAGTTGAGAAAGTGCATCCGGATGTTACCAAATATCGCATGTTAACTTCGTGAGCTCTCGCATTGAC
CTGCTTGTACAGCTTGAAGGAAGCATGAGGATAGACTTCTCTATGCCCCACACACATATGGTCTTTAAACATAAAGTATCATGAAAACCACGTTCTTGGC
GATGAACTGAGAGCTTATCTGCGGCCAACTTTCCAATGTCTCGTCATGCGACCCACCGTAGTGGTCCAGATAGTGTTGAATCCCCTTGGCAGGAGTTAGT
CATGGTCCTCACTTCGTCGGCGCCTCCGTGGTTGAAAAGGAGGTCGTATATGGGCGATGGTGATATTTATTCTCGGTCATCAATGGCGGCAATAGAGAAA
ATCGAAGCAGCTCTTATTGGCGGTCGGATGCTCTTGGTCGACCATCTCCAGGGCTTAAAACATTGGGCGTGATGCGACGGGGATTTGAGACGATGCCTTT
TTAAAGCGACCCGGTGAGCTAGACAACACGTAATCAAGTTTTGATATAAATCTCTATGTTTCGTTTCAACAACAATTATGGCATAAAATAAATGACTGGA
TCCCATATGCTACATCTTTGTAATTTGGAAGTGACACAGTCTTCTTGGATAATGTTAGTAATATGGTATATTCGAATGAAAATTCAAACCACTTTGTAAG
CTTTGTAATAATAAAGTGACACAGTCTCGCTCGGTAAATGATGTGGATAATATGATGATTTACTAATAATTATTAAACAGCTTCGCAACTTGCAAGTTAC
TAACTACATCTTCAAATGACTGAGTAAAGTGGAAATAGGACTCCACATGCTCGATTGAAGATGACCATGTTGGTAGTTAGTCTAATACTGCCCAATAGAA
AATCGCATTCTATGTTTGTCCTGGAAGGTCGTCAAAGTCAAGTTGAGAGCGACGGCGCTTTCTTCTACAGTAGCTTTTCTGCGCAAGACGCATGCGACAA
TCCTTTTCTGTCCCGACAGCGAT