Description :
Non Conding Region
Location :
Scaffold_1:48957- 49104
Sequence
147 bases(100 bases per row)
TACTTACTTACTTCGTAATCACTAGAGTAGCAATAAGTTTGTGCAAAATTGAGAATTACTAAGTAGTAATACGGTGGCGTATCTCGGTTAGACGAAAGTT
GTGCGAGTGTCGTGTTCAAATAAATAGTTATGGTGGCATTTCTCTCT